Incidental Mutation 'R5621:Ism1'
ID 441553
Institutional Source Beutler Lab
Gene Symbol Ism1
Ensembl Gene ENSMUSG00000074766
Gene Name isthmin 1, angiogenesis inhibitor
Synonyms 5430433G21Rik
MMRRC Submission 043279-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.710) question?
Stock # R5621 (G1)
Quality Score 103
Status Validated
Chromosome 2
Chromosomal Location 139678178-139758581 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 139678721 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 18 (T18A)
Ref Sequence ENSEMBL: ENSMUSP00000139280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099307] [ENSMUST00000184404]
AlphaFold A2ATD1
Predicted Effect probably damaging
Transcript: ENSMUST00000099307
AA Change: T18A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096910
Gene: ENSMUSG00000074766
AA Change: T18A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 165 177 N/A INTRINSIC
TSP1 210 252 3.69e-8 SMART
AMOP 279 442 5.38e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134801
Predicted Effect probably damaging
Transcript: ENSMUST00000184404
AA Change: T18A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139280
Gene: ENSMUSG00000074766
AA Change: T18A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 172 184 N/A INTRINSIC
TSP1 217 259 3.69e-8 SMART
AMOP 286 449 5.38e-91 SMART
Meta Mutation Damage Score 0.2124 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T G 17: 84,695,993 L417R probably damaging Het
Als2 A G 1: 59,191,890 V854A probably benign Het
Bbox1 C T 2: 110,292,523 W140* probably null Het
Ccdc28a A T 10: 18,216,268 N110K probably benign Het
Chrna6 C T 8: 27,407,040 E270K probably damaging Het
Cilp A G 9: 65,278,791 K723E possibly damaging Het
Ciz1 C A 2: 32,371,741 A455E probably damaging Het
Csmd3 T G 15: 48,313,978 H388P possibly damaging Het
Dnajc8 A G 4: 132,553,252 probably benign Het
Dnase1 G T 16: 4,039,118 C164F probably benign Het
Dync2h1 A T 9: 7,120,909 I2126K possibly damaging Het
Epha4 G T 1: 77,515,049 probably benign Het
Fer1l6 T C 15: 58,558,326 C201R probably damaging Het
Fgf8 T C 19: 45,742,382 Y68C probably benign Het
Gabrb1 A T 5: 72,108,728 I243F probably damaging Het
Gm13762 T C 2: 88,973,466 I142V probably benign Het
Gm9774 G A 3: 92,428,357 A346V probably damaging Het
Gpam A C 19: 55,079,260 S484A probably damaging Het
Hectd2 T A 19: 36,618,751 N745K probably damaging Het
Hspa13 T C 16: 75,766,763 probably benign Het
Ints2 A G 11: 86,242,947 F426L probably benign Het
Itih2 T A 2: 10,102,805 Q650L probably benign Het
Jmjd4 T C 11: 59,450,393 F50S probably damaging Het
Kif5b T C 18: 6,226,883 N125S probably benign Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Lrfn1 A G 7: 28,466,836 I552V probably damaging Het
Mcph1 A G 8: 18,632,170 E441G probably damaging Het
Mdn1 T A 4: 32,716,371 H2144Q possibly damaging Het
Mms19 A G 19: 41,966,313 S56P probably benign Het
Mrgprb3 A G 7: 48,643,368 I145T probably benign Het
Myh11 G A 16: 14,244,855 T287I probably damaging Het
Npas2 A G 1: 39,359,713 T730A probably benign Het
Olfr1229 G A 2: 89,282,353 P281L probably damaging Het
Pcdhgb1 A G 18: 37,682,169 E571G possibly damaging Het
Pcx T A 19: 4,619,167 V731E possibly damaging Het
Pgm1 T A 5: 64,112,038 Y489* probably null Het
Rrp12 T C 19: 41,880,417 T541A probably benign Het
Ryr3 C T 2: 112,900,984 W660* probably null Het
Sertad2 T A 11: 20,648,061 F86I possibly damaging Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc22a22 G T 15: 57,259,151 F143L probably benign Het
Slc22a28 C T 19: 8,071,011 V424I probably benign Het
Slc7a11 T G 3: 50,438,875 K106N probably damaging Het
Smgc A T 15: 91,844,420 D121V probably damaging Het
Sphk1 C T 11: 116,536,366 probably benign Het
Spock3 A T 8: 63,144,006 T118S probably benign Het
Stk17b G T 1: 53,771,784 S54* probably null Het
Sycp2 A G 2: 178,381,918 I435T probably benign Het
Tm2d3 G T 7: 65,701,618 D207Y probably damaging Het
Top2b A T 14: 16,387,280 N123Y probably damaging Het
Unc80 A G 1: 66,638,043 T2044A possibly damaging Het
Usp6nl A G 2: 6,440,432 S407G probably benign Het
Vmn1r195 G A 13: 22,278,389 V10I probably benign Het
Zfp292 C T 4: 34,811,703 R447H probably damaging Het
Other mutations in Ism1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Ism1 APN 2 139757303 missense probably damaging 1.00
IGL02496:Ism1 APN 2 139757201 missense probably damaging 1.00
IGL03349:Ism1 APN 2 139731975 nonsense probably null
R0212:Ism1 UTSW 2 139740257 missense probably benign 0.00
R0312:Ism1 UTSW 2 139678672 start codon destroyed probably null 0.88
R1355:Ism1 UTSW 2 139732074 missense possibly damaging 0.93
R1370:Ism1 UTSW 2 139732074 missense possibly damaging 0.93
R1775:Ism1 UTSW 2 139746043 missense probably damaging 1.00
R1992:Ism1 UTSW 2 139746017 missense probably benign 0.01
R2021:Ism1 UTSW 2 139740127 splice site probably null
R2035:Ism1 UTSW 2 139757155 missense probably damaging 1.00
R2270:Ism1 UTSW 2 139757373 missense probably damaging 1.00
R2271:Ism1 UTSW 2 139757373 missense probably damaging 1.00
R3722:Ism1 UTSW 2 139732011 nonsense probably null
R3792:Ism1 UTSW 2 139740253 missense probably damaging 0.99
R4907:Ism1 UTSW 2 139678752 missense probably benign 0.27
R5964:Ism1 UTSW 2 139678757 missense probably benign
R6255:Ism1 UTSW 2 139746042 small deletion probably benign
R7009:Ism1 UTSW 2 139757279 missense probably damaging 1.00
R7325:Ism1 UTSW 2 139757043 missense probably damaging 1.00
R7851:Ism1 UTSW 2 139757265 missense probably damaging 1.00
R8851:Ism1 UTSW 2 139749545 missense probably damaging 1.00
R8958:Ism1 UTSW 2 139732075 missense possibly damaging 0.93
R9365:Ism1 UTSW 2 139740401 missense probably damaging 1.00
Z1176:Ism1 UTSW 2 139731874 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGCTCCTGGGATTGCTCC -3'
(R):5'- CAATGTACCAAGCTCTCTTGC -3'

Sequencing Primer
(F):5'- TGGGATTGCTCCGCCAC -3'
(R):5'- CTTAGTACCTTGCGGGCCAC -3'
Posted On 2016-11-08