Incidental Mutation 'R5621:Slc7a11'
ID 441556
Institutional Source Beutler Lab
Gene Symbol Slc7a11
Ensembl Gene ENSMUSG00000027737
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 11
Synonyms sut, System x, x, 9930009M05Rik, xCT
MMRRC Submission 043279-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5621 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 49892526-50443614 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 50438875 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 106 (K106N)
Ref Sequence ENSEMBL: ENSMUSP00000029297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029297] [ENSMUST00000194462]
AlphaFold Q9WTR6
Predicted Effect probably damaging
Transcript: ENSMUST00000029297
AA Change: K106N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029297
Gene: ENSMUSG00000027737
AA Change: K106N

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 3.3e-61 PFAM
Pfam:AA_permease 49 478 1.1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193838
Predicted Effect probably damaging
Transcript: ENSMUST00000194462
AA Change: K106N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141988
Gene: ENSMUSG00000027737
AA Change: K106N

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 1.1e-60 PFAM
Pfam:AA_permease 49 479 2e-32 PFAM
Meta Mutation Damage Score 0.1126 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a heteromeric, sodium-independent, anionic amino acid transport system that is highly specific for cysteine and glutamate. In this system, designated Xc(-), the anionic form of cysteine is transported in exchange for glutamate. This protein has been identified as the predominant mediator of Kaposi sarcoma-associated herpesvirus fusion and entry permissiveness into cells. Also, increased expression of this gene in primary gliomas (compared to normal brain tissue) was associated with increased glutamate secretion via the XCT channels, resulting in neuronal cell death. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice show a reduction in yellow pigment resulting in dilution of agouti; only pinna hairs are affected in nonagouti mice. Mice homozygous for an ENU-induced allele exhibit decreased survival of LPS-induced macrophages and increased incidence of chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T G 17: 84,695,993 L417R probably damaging Het
Als2 A G 1: 59,191,890 V854A probably benign Het
Bbox1 C T 2: 110,292,523 W140* probably null Het
Ccdc28a A T 10: 18,216,268 N110K probably benign Het
Chrna6 C T 8: 27,407,040 E270K probably damaging Het
Cilp A G 9: 65,278,791 K723E possibly damaging Het
Ciz1 C A 2: 32,371,741 A455E probably damaging Het
Csmd3 T G 15: 48,313,978 H388P possibly damaging Het
Dnajc8 A G 4: 132,553,252 probably benign Het
Dnase1 G T 16: 4,039,118 C164F probably benign Het
Dync2h1 A T 9: 7,120,909 I2126K possibly damaging Het
Epha4 G T 1: 77,515,049 probably benign Het
Fer1l6 T C 15: 58,558,326 C201R probably damaging Het
Fgf8 T C 19: 45,742,382 Y68C probably benign Het
Gabrb1 A T 5: 72,108,728 I243F probably damaging Het
Gm13762 T C 2: 88,973,466 I142V probably benign Het
Gm9774 G A 3: 92,428,357 A346V probably damaging Het
Gpam A C 19: 55,079,260 S484A probably damaging Het
Hectd2 T A 19: 36,618,751 N745K probably damaging Het
Hspa13 T C 16: 75,766,763 probably benign Het
Ints2 A G 11: 86,242,947 F426L probably benign Het
Ism1 A G 2: 139,678,721 T18A probably damaging Het
Itih2 T A 2: 10,102,805 Q650L probably benign Het
Jmjd4 T C 11: 59,450,393 F50S probably damaging Het
Kif5b T C 18: 6,226,883 N125S probably benign Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Lrfn1 A G 7: 28,466,836 I552V probably damaging Het
Mcph1 A G 8: 18,632,170 E441G probably damaging Het
Mdn1 T A 4: 32,716,371 H2144Q possibly damaging Het
Mms19 A G 19: 41,966,313 S56P probably benign Het
Mrgprb3 A G 7: 48,643,368 I145T probably benign Het
Myh11 G A 16: 14,244,855 T287I probably damaging Het
Npas2 A G 1: 39,359,713 T730A probably benign Het
Olfr1229 G A 2: 89,282,353 P281L probably damaging Het
Pcdhgb1 A G 18: 37,682,169 E571G possibly damaging Het
Pcx T A 19: 4,619,167 V731E possibly damaging Het
Pgm1 T A 5: 64,112,038 Y489* probably null Het
Rrp12 T C 19: 41,880,417 T541A probably benign Het
Ryr3 C T 2: 112,900,984 W660* probably null Het
Sertad2 T A 11: 20,648,061 F86I possibly damaging Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc22a22 G T 15: 57,259,151 F143L probably benign Het
Slc22a28 C T 19: 8,071,011 V424I probably benign Het
Smgc A T 15: 91,844,420 D121V probably damaging Het
Sphk1 C T 11: 116,536,366 probably benign Het
Spock3 A T 8: 63,144,006 T118S probably benign Het
Stk17b G T 1: 53,771,784 S54* probably null Het
Sycp2 A G 2: 178,381,918 I435T probably benign Het
Tm2d3 G T 7: 65,701,618 D207Y probably damaging Het
Top2b A T 14: 16,387,280 N123Y probably damaging Het
Unc80 A G 1: 66,638,043 T2044A possibly damaging Het
Usp6nl A G 2: 6,440,432 S407G probably benign Het
Vmn1r195 G A 13: 22,278,389 V10I probably benign Het
Zfp292 C T 4: 34,811,703 R447H probably damaging Het
Other mutations in Slc7a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Slc7a11 APN 3 50427687 missense probably benign 0.06
IGL00990:Slc7a11 APN 3 50379069 missense probably damaging 1.00
IGL01755:Slc7a11 APN 3 50424067 missense probably benign 0.39
IGL03105:Slc7a11 APN 3 50372339 missense possibly damaging 0.67
IGL03141:Slc7a11 APN 3 50381885 missense possibly damaging 0.66
R0468:Slc7a11 UTSW 3 50384051 missense probably damaging 1.00
R0735:Slc7a11 UTSW 3 50424096 missense probably benign 0.00
R1363:Slc7a11 UTSW 3 50424051 missense probably damaging 1.00
R1466:Slc7a11 UTSW 3 50381073 splice site probably null
R1466:Slc7a11 UTSW 3 50381073 splice site probably null
R1554:Slc7a11 UTSW 3 50381896 missense probably damaging 1.00
R1734:Slc7a11 UTSW 3 50372346 nonsense probably null
R2128:Slc7a11 UTSW 3 50384109 missense probably damaging 0.97
R2504:Slc7a11 UTSW 3 50377746 splice site probably null
R3116:Slc7a11 UTSW 3 50384139 missense probably benign 0.13
R3981:Slc7a11 UTSW 3 50427774 missense probably benign
R4479:Slc7a11 UTSW 3 50417963 intron probably benign
R5117:Slc7a11 UTSW 3 50379150 missense probably damaging 0.99
R5586:Slc7a11 UTSW 3 50443083 missense possibly damaging 0.95
R5689:Slc7a11 UTSW 3 50372331 missense probably benign 0.01
R5692:Slc7a11 UTSW 3 50372331 missense probably benign 0.01
R5965:Slc7a11 UTSW 3 50379144 missense probably benign 0.00
R6338:Slc7a11 UTSW 3 50384043 critical splice donor site probably null
R7177:Slc7a11 UTSW 3 50443231 missense probably benign 0.00
R7337:Slc7a11 UTSW 3 50442999 missense possibly damaging 0.50
R7634:Slc7a11 UTSW 3 50424037 splice site probably null
R7756:Slc7a11 UTSW 3 50372360 missense probably benign
R7758:Slc7a11 UTSW 3 50372360 missense probably benign
R7821:Slc7a11 UTSW 3 50381027 missense probably damaging 1.00
R8112:Slc7a11 UTSW 3 50417991 missense possibly damaging 0.92
R8218:Slc7a11 UTSW 3 50424052 missense probably damaging 1.00
R8255:Slc7a11 UTSW 3 50427728 missense probably damaging 0.98
R8318:Slc7a11 UTSW 3 50417986 critical splice donor site probably null
R8396:Slc7a11 UTSW 3 50384129 missense possibly damaging 0.78
R8857:Slc7a11 UTSW 3 50438856 missense probably damaging 1.00
R8967:Slc7a11 UTSW 3 50384115 missense probably benign 0.00
R9044:Slc7a11 UTSW 3 50379183 missense probably benign 0.20
R9104:Slc7a11 UTSW 3 50377633 missense probably benign 0.01
R9404:Slc7a11 UTSW 3 50381039 missense possibly damaging 0.64
R9500:Slc7a11 UTSW 3 50427752 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGTCTGTATTTGTTCAACTAAGTC -3'
(R):5'- GGTGGGTCTCAGTTAGAAGATGAC -3'

Sequencing Primer
(F):5'- GACACACATCTGTAATTAGTTCAAGC -3'
(R):5'- GATGACAACTGTTCCCATGAAGGTC -3'
Posted On 2016-11-08