Incidental Mutation 'R5621:Gm9774'
ID441557
Institutional Source Beutler Lab
Gene Symbol Gm9774
Ensembl Gene ENSMUSG00000042165
Gene Namepredicted pseudogene 9774
Synonyms
MMRRC Submission 043279-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.592) question?
Stock #R5621 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location92428032-92429423 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 92428357 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 346 (A346V)
Ref Sequence ENSEMBL: ENSMUSP00000141274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047300] [ENSMUST00000067102] [ENSMUST00000192538]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047300
AA Change: A248V

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045065
Gene: ENSMUSG00000042165
AA Change: A248V

DomainStartEndE-ValueType
Pfam:Proteasom_Rpn13 29 111 5.8e-36 PFAM
low complexity region 132 150 N/A INTRINSIC
Pfam:RPN13_C 170 283 7.5e-38 PFAM
low complexity region 292 305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067102
SMART Domains Protein: ENSMUSP00000063287
Gene: ENSMUSG00000054215

DomainStartEndE-ValueType
Pfam:SPRR2 2 65 1.8e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192538
AA Change: A346V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141274
Gene: ENSMUSG00000042165
AA Change: A346V

DomainStartEndE-ValueType
Pfam:Proteasom_Rpn13 29 112 7.4e-35 PFAM
low complexity region 135 161 N/A INTRINSIC
low complexity region 173 254 N/A INTRINSIC
PDB:2KR0|A 255 407 4e-78 PDB
Meta Mutation Damage Score 0.8137 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T G 17: 84,695,993 L417R probably damaging Het
Als2 A G 1: 59,191,890 V854A probably benign Het
Bbox1 C T 2: 110,292,523 W140* probably null Het
Ccdc28a A T 10: 18,216,268 N110K probably benign Het
Chrna6 C T 8: 27,407,040 E270K probably damaging Het
Cilp A G 9: 65,278,791 K723E possibly damaging Het
Ciz1 C A 2: 32,371,741 A455E probably damaging Het
Csmd3 T G 15: 48,313,978 H388P possibly damaging Het
Dnajc8 A G 4: 132,553,252 probably benign Het
Dnase1 G T 16: 4,039,118 C164F probably benign Het
Dync2h1 A T 9: 7,120,909 I2126K possibly damaging Het
Epha4 G T 1: 77,515,049 probably benign Het
Fer1l6 T C 15: 58,558,326 C201R probably damaging Het
Fgf8 T C 19: 45,742,382 Y68C probably benign Het
Gabrb1 A T 5: 72,108,728 I243F probably damaging Het
Gm13762 T C 2: 88,973,466 I142V probably benign Het
Gpam A C 19: 55,079,260 S484A probably damaging Het
Hectd2 T A 19: 36,618,751 N745K probably damaging Het
Hspa13 T C 16: 75,766,763 probably benign Het
Ints2 A G 11: 86,242,947 F426L probably benign Het
Ism1 A G 2: 139,678,721 T18A probably damaging Het
Itih2 T A 2: 10,102,805 Q650L probably benign Het
Jmjd4 T C 11: 59,450,393 F50S probably damaging Het
Kif5b T C 18: 6,226,883 N125S probably benign Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Lrfn1 A G 7: 28,466,836 I552V probably damaging Het
Mcph1 A G 8: 18,632,170 E441G probably damaging Het
Mdn1 T A 4: 32,716,371 H2144Q possibly damaging Het
Mms19 A G 19: 41,966,313 S56P probably benign Het
Mrgprb3 A G 7: 48,643,368 I145T probably benign Het
Myh11 G A 16: 14,244,855 T287I probably damaging Het
Npas2 A G 1: 39,359,713 T730A probably benign Het
Olfr1229 G A 2: 89,282,353 P281L probably damaging Het
Pcdhgb1 A G 18: 37,682,169 E571G possibly damaging Het
Pcx T A 19: 4,619,167 V731E possibly damaging Het
Pgm1 T A 5: 64,112,038 Y489* probably null Het
Rrp12 T C 19: 41,880,417 T541A probably benign Het
Ryr3 C T 2: 112,900,984 W660* probably null Het
Sertad2 T A 11: 20,648,061 F86I possibly damaging Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc22a22 G T 15: 57,259,151 F143L probably benign Het
Slc22a28 C T 19: 8,071,011 V424I probably benign Het
Slc7a11 T G 3: 50,438,875 K106N probably damaging Het
Smgc A T 15: 91,844,420 D121V probably damaging Het
Sphk1 C T 11: 116,536,366 probably benign Het
Spock3 A T 8: 63,144,006 T118S probably benign Het
Stk17b G T 1: 53,771,784 S54* probably null Het
Sycp2 A G 2: 178,381,918 I435T probably benign Het
Tm2d3 G T 7: 65,701,618 D207Y probably damaging Het
Top2b A T 14: 16,387,280 N123Y probably damaging Het
Unc80 A G 1: 66,638,043 T2044A possibly damaging Het
Usp6nl A G 2: 6,440,432 S407G probably benign Het
Vmn1r195 G A 13: 22,278,389 V10I probably benign Het
Zfp292 C T 4: 34,811,703 R447H probably damaging Het
Other mutations in Gm9774
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Gm9774 APN 3 92428400 missense probably benign 0.06
IGL01474:Gm9774 APN 3 92428343 missense probably damaging 0.99
R0634:Gm9774 UTSW 3 92428809 nonsense probably null
R1791:Gm9774 UTSW 3 92428231 missense probably damaging 0.99
R2215:Gm9774 UTSW 3 92428423 missense probably damaging 0.97
R4077:Gm9774 UTSW 3 92428888 unclassified probably benign
R5221:Gm9774 UTSW 3 92428508 missense probably benign 0.00
R5481:Gm9774 UTSW 3 92429351 missense possibly damaging 0.94
R5589:Gm9774 UTSW 3 92428805 unclassified probably benign
R5611:Gm9774 UTSW 3 92428451 missense probably damaging 1.00
R6012:Gm9774 UTSW 3 92429484 unclassified probably null
R6538:Gm9774 UTSW 3 92429255 missense possibly damaging 0.76
R6773:Gm9774 UTSW 3 92429249 missense probably damaging 0.99
R6995:Gm9774 UTSW 3 92429008 unclassified probably benign
R8055:Gm9774 UTSW 3 92428832 missense unknown
Z1088:Gm9774 UTSW 3 92429090 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACCAATTCCAACTTGGGGAC -3'
(R):5'- ACTATGAACGTGCCGGCATG -3'

Sequencing Primer
(F):5'- ATTCCAACTTGGGGACGGACAC -3'
(R):5'- CAGCCAGCAAGTGGATCTG -3'
Posted On2016-11-08