Incidental Mutation 'R5621:Gabrb1'
ID441562
Institutional Source Beutler Lab
Gene Symbol Gabrb1
Ensembl Gene ENSMUSG00000029212
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit beta 1
SynonymsGabrb-1, B230208N19Rik
MMRRC Submission 043279-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5621 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location71658113-72149037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72108728 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 243 (I243F)
Ref Sequence ENSEMBL: ENSMUSP00000031122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031122] [ENSMUST00000199967]
Predicted Effect probably damaging
Transcript: ENSMUST00000031122
AA Change: I243F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031122
Gene: ENSMUSG00000029212
AA Change: I243F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 7.1e-52 PFAM
Pfam:Neur_chan_memb 250 469 2.4e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199967
AA Change: I210F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143682
Gene: ENSMUSG00000029212
AA Change: I210F

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 4 210 4.8e-51 PFAM
Meta Mutation Damage Score 0.8685 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 1 subunit. It is mapped to chromosome 4p12 in a cluster comprised of genes encoding alpha 4, alpha 2 and gamma 1 subunits of the GABA A receptor. Alteration of this gene is implicated in the pathogenetics of schizophrenia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for an ENU or spontaneous mutation exhibit alcohol preference with increased tonic inhibition, female infertility and hypothalamic pituitary axis dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T G 17: 84,695,993 L417R probably damaging Het
Als2 A G 1: 59,191,890 V854A probably benign Het
Bbox1 C T 2: 110,292,523 W140* probably null Het
Ccdc28a A T 10: 18,216,268 N110K probably benign Het
Chrna6 C T 8: 27,407,040 E270K probably damaging Het
Cilp A G 9: 65,278,791 K723E possibly damaging Het
Ciz1 C A 2: 32,371,741 A455E probably damaging Het
Csmd3 T G 15: 48,313,978 H388P possibly damaging Het
Dnajc8 A G 4: 132,553,252 probably benign Het
Dnase1 G T 16: 4,039,118 C164F probably benign Het
Dync2h1 A T 9: 7,120,909 I2126K possibly damaging Het
Epha4 G T 1: 77,515,049 probably benign Het
Fer1l6 T C 15: 58,558,326 C201R probably damaging Het
Fgf8 T C 19: 45,742,382 Y68C probably benign Het
Gm13762 T C 2: 88,973,466 I142V probably benign Het
Gm9774 G A 3: 92,428,357 A346V probably damaging Het
Gpam A C 19: 55,079,260 S484A probably damaging Het
Hectd2 T A 19: 36,618,751 N745K probably damaging Het
Hspa13 T C 16: 75,766,763 probably benign Het
Ints2 A G 11: 86,242,947 F426L probably benign Het
Ism1 A G 2: 139,678,721 T18A probably damaging Het
Itih2 T A 2: 10,102,805 Q650L probably benign Het
Jmjd4 T C 11: 59,450,393 F50S probably damaging Het
Kif5b T C 18: 6,226,883 N125S probably benign Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Lrfn1 A G 7: 28,466,836 I552V probably damaging Het
Mcph1 A G 8: 18,632,170 E441G probably damaging Het
Mdn1 T A 4: 32,716,371 H2144Q possibly damaging Het
Mms19 A G 19: 41,966,313 S56P probably benign Het
Mrgprb3 A G 7: 48,643,368 I145T probably benign Het
Myh11 G A 16: 14,244,855 T287I probably damaging Het
Npas2 A G 1: 39,359,713 T730A probably benign Het
Olfr1229 G A 2: 89,282,353 P281L probably damaging Het
Pcdhgb1 A G 18: 37,682,169 E571G possibly damaging Het
Pcx T A 19: 4,619,167 V731E possibly damaging Het
Pgm1 T A 5: 64,112,038 Y489* probably null Het
Rrp12 T C 19: 41,880,417 T541A probably benign Het
Ryr3 C T 2: 112,900,984 W660* probably null Het
Sertad2 T A 11: 20,648,061 F86I possibly damaging Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc22a22 G T 15: 57,259,151 F143L probably benign Het
Slc22a28 C T 19: 8,071,011 V424I probably benign Het
Slc7a11 T G 3: 50,438,875 K106N probably damaging Het
Smgc A T 15: 91,844,420 D121V probably damaging Het
Sphk1 C T 11: 116,536,366 probably benign Het
Spock3 A T 8: 63,144,006 T118S probably benign Het
Stk17b G T 1: 53,771,784 S54* probably null Het
Sycp2 A G 2: 178,381,918 I435T probably benign Het
Tm2d3 G T 7: 65,701,618 D207Y probably damaging Het
Top2b A T 14: 16,387,280 N123Y probably damaging Het
Unc80 A G 1: 66,638,043 T2044A possibly damaging Het
Usp6nl A G 2: 6,440,432 S407G probably benign Het
Vmn1r195 G A 13: 22,278,389 V10I probably benign Het
Zfp292 C T 4: 34,811,703 R447H probably damaging Het
Other mutations in Gabrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Gabrb1 APN 5 72108446 critical splice donor site probably null
IGL00774:Gabrb1 APN 5 72108446 critical splice donor site probably null
IGL01534:Gabrb1 APN 5 71869429 missense possibly damaging 0.95
IGL02170:Gabrb1 APN 5 72136730 missense probably damaging 1.00
IGL02326:Gabrb1 APN 5 71700847 missense probably damaging 0.99
IGL03278:Gabrb1 APN 5 71869596 missense probably damaging 1.00
IGL03345:Gabrb1 APN 5 72136565 missense possibly damaging 0.53
IGL03050:Gabrb1 UTSW 5 72122154 missense probably benign 0.03
PIT4445001:Gabrb1 UTSW 5 72108782 missense probably damaging 1.00
PIT4515001:Gabrb1 UTSW 5 71700817 missense probably damaging 1.00
R0109:Gabrb1 UTSW 5 72121946 splice site probably benign
R0386:Gabrb1 UTSW 5 72108807 missense probably damaging 0.99
R1512:Gabrb1 UTSW 5 72108704 missense probably damaging 1.00
R1512:Gabrb1 UTSW 5 72108705 missense probably damaging 1.00
R1717:Gabrb1 UTSW 5 72108351 splice site probably null
R1832:Gabrb1 UTSW 5 72121938 splice site probably null
R1961:Gabrb1 UTSW 5 71700336 missense probably benign 0.28
R2363:Gabrb1 UTSW 5 71869573 nonsense probably null
R4686:Gabrb1 UTSW 5 71700022 missense possibly damaging 0.53
R4840:Gabrb1 UTSW 5 71700811 missense probably damaging 1.00
R4916:Gabrb1 UTSW 5 71869421 missense probably damaging 1.00
R4941:Gabrb1 UTSW 5 72136778 missense probably damaging 1.00
R5250:Gabrb1 UTSW 5 71869579 missense possibly damaging 0.80
R5270:Gabrb1 UTSW 5 72108326 missense probably damaging 1.00
R5364:Gabrb1 UTSW 5 72136762 missense probably benign 0.33
R5407:Gabrb1 UTSW 5 72122021 missense possibly damaging 0.90
R5790:Gabrb1 UTSW 5 72136484 missense possibly damaging 0.53
R6236:Gabrb1 UTSW 5 72108320 missense probably damaging 1.00
R6336:Gabrb1 UTSW 5 72029898 missense possibly damaging 0.72
R7411:Gabrb1 UTSW 5 72122195 critical splice donor site probably null
R8375:Gabrb1 UTSW 5 72029829 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACTTGTGCGTTGTGAAAGAG -3'
(R):5'- TTAAGCGTCCCATTGCAGCC -3'

Sequencing Primer
(F):5'- CTTGTGCGTTGTGAAAGAGAGATAG -3'
(R):5'- GCGTCCCATTGCAGCCTAATTC -3'
Posted On2016-11-08