Mutagenetix > Incidental Mutations

Incidental Mutation 'R5621:Ints2'

441574

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

043279-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5621 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86242947 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 426 (F426L)

Ref Sequence

ENSEMBL: ENSMUSP00000103674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

Predicted Effect

probably benign
Transcript: ENSMUST00000018212
AA Change: F426L

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: F426L

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108039
AA Change: F426L

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: F426L

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127745

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134883

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Meta Mutation Damage Score

0.0998

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.2%
20x: 95.0%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg8	T	G	17: 84,695,993	L417R	probably damaging	Het
Als2	A	G	1: 59,191,890	V854A	probably benign	Het
Bbox1	C	T	2: 110,292,523	W140*	probably null	Het
Ccdc28a	A	T	10: 18,216,268	N110K	probably benign	Het
Chrna6	C	T	8: 27,407,040	E270K	probably damaging	Het
Cilp	A	G	9: 65,278,791	K723E	possibly damaging	Het
Ciz1	C	A	2: 32,371,741	A455E	probably damaging	Het
Csmd3	T	G	15: 48,313,978	H388P	possibly damaging	Het
Dnajc8	A	G	4: 132,553,252		probably benign	Het
Dnase1	G	T	16: 4,039,118	C164F	probably benign	Het
Dync2h1	A	T	9: 7,120,909	I2126K	possibly damaging	Het
Epha4	G	T	1: 77,515,049		probably benign	Het
Fer1l6	T	C	15: 58,558,326	C201R	probably damaging	Het
Fgf8	T	C	19: 45,742,382	Y68C	probably benign	Het
Gabrb1	A	T	5: 72,108,728	I243F	probably damaging	Het
Gm13762	T	C	2: 88,973,466	I142V	probably benign	Het
Gm9774	G	A	3: 92,428,357	A346V	probably damaging	Het
Gpam	A	C	19: 55,079,260	S484A	probably damaging	Het
Hectd2	T	A	19: 36,618,751	N745K	probably damaging	Het
Hspa13	T	C	16: 75,766,763		probably benign	Het
Ism1	A	G	2: 139,678,721	T18A	probably damaging	Het
Itih2	T	A	2: 10,102,805	Q650L	probably benign	Het
Jmjd4	T	C	11: 59,450,393	F50S	probably damaging	Het
Kif5b	T	C	18: 6,226,883	N125S	probably benign	Het
Lonp1	G	C	17: 56,620,263	A330G	probably benign	Het
Lrfn1	A	G	7: 28,466,836	I552V	probably damaging	Het
Mcph1	A	G	8: 18,632,170	E441G	probably damaging	Het
Mdn1	T	A	4: 32,716,371	H2144Q	possibly damaging	Het
Mms19	A	G	19: 41,966,313	S56P	probably benign	Het
Mrgprb3	A	G	7: 48,643,368	I145T	probably benign	Het
Myh11	G	A	16: 14,244,855	T287I	probably damaging	Het
Npas2	A	G	1: 39,359,713	T730A	probably benign	Het
Olfr1229	G	A	2: 89,282,353	P281L	probably damaging	Het
Pcdhgb1	A	G	18: 37,682,169	E571G	possibly damaging	Het
Pcx	T	A	19: 4,619,167	V731E	possibly damaging	Het
Pgm1	T	A	5: 64,112,038	Y489*	probably null	Het
Rrp12	T	C	19: 41,880,417	T541A	probably benign	Het
Ryr3	C	T	2: 112,900,984	W660*	probably null	Het
Sertad2	T	A	11: 20,648,061	F86I	possibly damaging	Het
Slc11a1	G	A	1: 74,380,906	G191D	probably damaging	Het
Slc22a22	G	T	15: 57,259,151	F143L	probably benign	Het
Slc22a28	C	T	19: 8,071,011	V424I	probably benign	Het
Slc7a11	T	G	3: 50,438,875	K106N	probably damaging	Het
Smgc	A	T	15: 91,844,420	D121V	probably damaging	Het
Sphk1	C	T	11: 116,536,366		probably benign	Het
Spock3	A	T	8: 63,144,006	T118S	probably benign	Het
Stk17b	G	T	1: 53,771,784	S54*	probably null	Het
Sycp2	A	G	2: 178,381,918	I435T	probably benign	Het
Tm2d3	G	T	7: 65,701,618	D207Y	probably damaging	Het
Top2b	A	T	14: 16,387,280	N123Y	probably damaging	Het
Unc80	A	G	1: 66,638,043	T2044A	possibly damaging	Het
Usp6nl	A	G	2: 6,440,432	S407G	probably benign	Het
Vmn1r195	G	A	13: 22,278,389	V10I	probably benign	Het
Zfp292	C	T	4: 34,811,703	R447H	probably damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7928:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7958:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- ATATTGGCCAGTTTCTGTGGTAAAC -3'
(R):5'- TGTGTGCTACTCACCTGCAG -3'

Sequencing Primer
(F):5'- TGCTACCTACACTACACG -3'
(R):5'- CAGTGCGGTTAAAAAGTTTGC -3'

Posted On

2016-11-08