Mutagenetix > Incidental Mutation

Incidental Mutation 'R5621:Top2b'

441577

Institutional Source

Beutler Lab

Gene Symbol

Top2b

Ensembl Gene

ENSMUSG00000017485

Gene Name

topoisomerase (DNA) II beta

Synonyms

D230016L12Rik, Top-2

MMRRC Submission

043279-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.922) question?

Stock #

R5621 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16365179-16435462 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 16387280 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 123 (N123Y)

Ref Sequence

ENSEMBL: ENSMUSP00000017629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017629]

AlphaFold

Q64511

Predicted Effect

probably damaging
Transcript: ENSMUST00000017629
AA Change: N123Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: N123Y

Domain	Start	End	E-Value	Type
Blast:TOP2c	32	70	7e-10	BLAST
HATPase_c	85	234	1.91e-2	SMART
TOP2c	89	679	N/A	SMART
TOP4c	702	1175	2.55e-230	SMART
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1287	1299	N/A	INTRINSIC
low complexity region	1324	1336	N/A	INTRINSIC
low complexity region	1360	1382	N/A	INTRINSIC
Pfam:DTHCT	1495	1597	4.6e-31	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159987

Meta Mutation Damage Score

0.6479

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.2%
20x: 95.0%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg8	T	G	17: 84,695,993	L417R	probably damaging	Het
Als2	A	G	1: 59,191,890	V854A	probably benign	Het
Bbox1	C	T	2: 110,292,523	W140*	probably null	Het
Ccdc28a	A	T	10: 18,216,268	N110K	probably benign	Het
Chrna6	C	T	8: 27,407,040	E270K	probably damaging	Het
Cilp	A	G	9: 65,278,791	K723E	possibly damaging	Het
Ciz1	C	A	2: 32,371,741	A455E	probably damaging	Het
Csmd3	T	G	15: 48,313,978	H388P	possibly damaging	Het
Dnajc8	A	G	4: 132,553,252		probably benign	Het
Dnase1	G	T	16: 4,039,118	C164F	probably benign	Het
Dync2h1	A	T	9: 7,120,909	I2126K	possibly damaging	Het
Epha4	G	T	1: 77,515,049		probably benign	Het
Fer1l6	T	C	15: 58,558,326	C201R	probably damaging	Het
Fgf8	T	C	19: 45,742,382	Y68C	probably benign	Het
Gabrb1	A	T	5: 72,108,728	I243F	probably damaging	Het
Gm13762	T	C	2: 88,973,466	I142V	probably benign	Het
Gm9774	G	A	3: 92,428,357	A346V	probably damaging	Het
Gpam	A	C	19: 55,079,260	S484A	probably damaging	Het
Hectd2	T	A	19: 36,618,751	N745K	probably damaging	Het
Hspa13	T	C	16: 75,766,763		probably benign	Het
Ints2	A	G	11: 86,242,947	F426L	probably benign	Het
Ism1	A	G	2: 139,678,721	T18A	probably damaging	Het
Itih2	T	A	2: 10,102,805	Q650L	probably benign	Het
Jmjd4	T	C	11: 59,450,393	F50S	probably damaging	Het
Kif5b	T	C	18: 6,226,883	N125S	probably benign	Het
Lonp1	G	C	17: 56,620,263	A330G	probably benign	Het
Lrfn1	A	G	7: 28,466,836	I552V	probably damaging	Het
Mcph1	A	G	8: 18,632,170	E441G	probably damaging	Het
Mdn1	T	A	4: 32,716,371	H2144Q	possibly damaging	Het
Mms19	A	G	19: 41,966,313	S56P	probably benign	Het
Mrgprb3	A	G	7: 48,643,368	I145T	probably benign	Het
Myh11	G	A	16: 14,244,855	T287I	probably damaging	Het
Npas2	A	G	1: 39,359,713	T730A	probably benign	Het
Olfr1229	G	A	2: 89,282,353	P281L	probably damaging	Het
Pcdhgb1	A	G	18: 37,682,169	E571G	possibly damaging	Het
Pcx	T	A	19: 4,619,167	V731E	possibly damaging	Het
Pgm1	T	A	5: 64,112,038	Y489*	probably null	Het
Rrp12	T	C	19: 41,880,417	T541A	probably benign	Het
Ryr3	C	T	2: 112,900,984	W660*	probably null	Het
Sertad2	T	A	11: 20,648,061	F86I	possibly damaging	Het
Slc11a1	G	A	1: 74,380,906	G191D	probably damaging	Het
Slc22a22	G	T	15: 57,259,151	F143L	probably benign	Het
Slc22a28	C	T	19: 8,071,011	V424I	probably benign	Het
Slc7a11	T	G	3: 50,438,875	K106N	probably damaging	Het
Smgc	A	T	15: 91,844,420	D121V	probably damaging	Het
Sphk1	C	T	11: 116,536,366		probably benign	Het
Spock3	A	T	8: 63,144,006	T118S	probably benign	Het
Stk17b	G	T	1: 53,771,784	S54*	probably null	Het
Sycp2	A	G	2: 178,381,918	I435T	probably benign	Het
Tm2d3	G	T	7: 65,701,618	D207Y	probably damaging	Het
Unc80	A	G	1: 66,638,043	T2044A	possibly damaging	Het
Usp6nl	A	G	2: 6,440,432	S407G	probably benign	Het
Vmn1r195	G	A	13: 22,278,389	V10I	probably benign	Het
Zfp292	C	T	4: 34,811,703	R447H	probably damaging	Het

Other mutations in Top2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Top2b	APN	14	16422692	missense	probably benign	0.00
IGL00730:Top2b	APN	14	16389831	missense	probably damaging	1.00
IGL00917:Top2b	APN	14	16407354	missense	probably benign	0.05
IGL01959:Top2b	APN	14	16422695	missense	probably benign	0.19
IGL02019:Top2b	APN	14	16409965	missense	probably benign	0.44
IGL02119:Top2b	APN	14	16406733	missense	probably damaging	1.00
IGL02136:Top2b	APN	14	16407103	unclassified	probably benign
IGL02148:Top2b	APN	14	16400488	missense	probably damaging	1.00
IGL02496:Top2b	APN	14	16387335	missense	probably benign
IGL02503:Top2b	APN	14	16407163	missense	possibly damaging	0.92
IGL02672:Top2b	APN	14	16409166	unclassified	probably benign
IGL02721:Top2b	APN	14	16409236	missense	probably damaging	1.00
IGL02886:Top2b	APN	14	16365688	missense	possibly damaging	0.73
IGL03252:Top2b	APN	14	16393163	missense	possibly damaging	0.60
PIT4434001:Top2b	UTSW	14	16423780	critical splice donor site	probably null
R0092:Top2b	UTSW	14	16409263	missense	probably damaging	1.00
R0201:Top2b	UTSW	14	16383174	missense	probably damaging	1.00
R0390:Top2b	UTSW	14	16418442	missense	probably benign	0.00
R0394:Top2b	UTSW	14	16413556	splice site	probably null
R1159:Top2b	UTSW	14	16430329	missense	possibly damaging	0.81
R1424:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R1519:Top2b	UTSW	14	16408953	splice site	probably null
R1561:Top2b	UTSW	14	16398993	missense	possibly damaging	0.80
R1713:Top2b	UTSW	14	16409823	missense	probably benign	0.05
R1987:Top2b	UTSW	14	16398916	missense	probably damaging	0.99
R2219:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2287:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2422:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2679:Top2b	UTSW	14	16413947	missense	probably damaging	1.00
R3687:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3707:Top2b	UTSW	14	16388447	missense	probably damaging	1.00
R3810:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3812:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3815:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3816:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3818:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4023:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4025:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4026:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4133:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4157:Top2b	UTSW	14	16384491	missense	probably benign	0.42
R4179:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4180:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4300:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4376:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4377:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4492:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4549:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4550:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4581:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4582:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4628:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4630:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4667:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4668:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4669:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4698:Top2b	UTSW	14	16387331	nonsense	probably null
R4769:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R4809:Top2b	UTSW	14	16383125	missense	probably benign	0.06
R4899:Top2b	UTSW	14	16387313	missense	probably damaging	1.00
R5035:Top2b	UTSW	14	16409966	missense	probably benign	0.01
R5631:Top2b	UTSW	14	16409882	missense	probably damaging	1.00
R5685:Top2b	UTSW	14	16413666	missense	probably damaging	1.00
R5732:Top2b	UTSW	14	16400106	missense	possibly damaging	0.92
R5939:Top2b	UTSW	14	16422786	missense	probably damaging	0.96
R6007:Top2b	UTSW	14	16423779	critical splice donor site	probably null
R6087:Top2b	UTSW	14	16409864	missense	probably benign	0.14
R6144:Top2b	UTSW	14	16423740	missense	possibly damaging	0.48
R6196:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6218:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6229:Top2b	UTSW	14	16409838	missense	probably damaging	1.00
R6249:Top2b	UTSW	14	16399006	missense	probably damaging	1.00
R6337:Top2b	UTSW	14	16399026	missense	possibly damaging	0.77
R6353:Top2b	UTSW	14	16416671	missense	probably damaging	1.00
R6512:Top2b	UTSW	14	16409854	missense	possibly damaging	0.94
R6573:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R6614:Top2b	UTSW	14	16407142	nonsense	probably null
R6844:Top2b	UTSW	14	16429383	missense	possibly damaging	0.94
R6848:Top2b	UTSW	14	16409958	missense	possibly damaging	0.89
R6871:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6895:Top2b	UTSW	14	16413604	missense	probably benign	0.06
R7162:Top2b	UTSW	14	16416653	missense	probably benign	0.00
R7247:Top2b	UTSW	14	16416962	missense	probably benign	0.08
R7250:Top2b	UTSW	14	16420411	missense	probably benign
R7359:Top2b	UTSW	14	16407376	missense	probably null	1.00
R7365:Top2b	UTSW	14	16416649	missense	probably benign	0.04
R7493:Top2b	UTSW	14	16416605	missense	probably benign	0.00
R7528:Top2b	UTSW	14	16395427	nonsense	probably null
R7562:Top2b	UTSW	14	16412946	missense	probably benign	0.04
R7594:Top2b	UTSW	14	16428587	missense	probably benign
R7670:Top2b	UTSW	14	16416620	missense	possibly damaging	0.61
R7894:Top2b	UTSW	14	16413081	missense	possibly damaging	0.68
R8031:Top2b	UTSW	14	16412986	missense	probably damaging	0.98
R8150:Top2b	UTSW	14	16393291	missense	probably damaging	0.99
R8214:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R8299:Top2b	UTSW	14	16386123	missense	possibly damaging	0.68
R8977:Top2b	UTSW	14	16393239	missense	probably benign	0.36
R9562:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9565:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9798:Top2b	UTSW	14	16389845	missense	probably damaging	1.00
X0028:Top2b	UTSW	14	16384499	nonsense	probably null
Z1176:Top2b	UTSW	14	16395434	missense	probably damaging	1.00
Z1177:Top2b	UTSW	14	16416953	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTTGGAGATGGAGAAAGGTTTATTC -3'
(R):5'- TCAGAACGCAAACTGTCAGTTAG -3'

Sequencing Primer
(F):5'- TCTAAGAAATGTTGCAGATCTTACTG -3'
(R):5'- GAACGCAAACTGTCAGTTAGATTAG -3'

Posted On

2016-11-08