Incidental Mutation 'R5621:Kif5b'
ID 441588
Institutional Source Beutler Lab
Gene Symbol Kif5b
Ensembl Gene ENSMUSG00000006740
Gene Name kinesin family member 5B
Synonyms kinesin heavy chain, Khc
MMRRC Submission 043279-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5621 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 6201002-6242174 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6226883 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 125 (N125S)
Ref Sequence ENSEMBL: ENSMUSP00000025083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025083] [ENSMUST00000163210]
AlphaFold Q61768
Predicted Effect probably benign
Transcript: ENSMUST00000025083
AA Change: N125S

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025083
Gene: ENSMUSG00000006740
AA Change: N125S

DomainStartEndE-ValueType
KISc 6 333 4.48e-172 SMART
low complexity region 341 352 N/A INTRINSIC
coiled coil region 412 564 N/A INTRINSIC
coiled coil region 596 802 N/A INTRINSIC
coiled coil region 825 914 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163210
AA Change: N125S

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000130750
Gene: ENSMUSG00000006740
AA Change: N125S

DomainStartEndE-ValueType
KISc 6 333 4.48e-172 SMART
low complexity region 341 352 N/A INTRINSIC
coiled coil region 412 564 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168187
Meta Mutation Damage Score 0.0775 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (63/64)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos during organogenesis, exhibit growth retardation and fail to turn during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T G 17: 84,695,993 L417R probably damaging Het
Als2 A G 1: 59,191,890 V854A probably benign Het
Bbox1 C T 2: 110,292,523 W140* probably null Het
Ccdc28a A T 10: 18,216,268 N110K probably benign Het
Chrna6 C T 8: 27,407,040 E270K probably damaging Het
Cilp A G 9: 65,278,791 K723E possibly damaging Het
Ciz1 C A 2: 32,371,741 A455E probably damaging Het
Csmd3 T G 15: 48,313,978 H388P possibly damaging Het
Dnajc8 A G 4: 132,553,252 probably benign Het
Dnase1 G T 16: 4,039,118 C164F probably benign Het
Dync2h1 A T 9: 7,120,909 I2126K possibly damaging Het
Epha4 G T 1: 77,515,049 probably benign Het
Fer1l6 T C 15: 58,558,326 C201R probably damaging Het
Fgf8 T C 19: 45,742,382 Y68C probably benign Het
Gabrb1 A T 5: 72,108,728 I243F probably damaging Het
Gm13762 T C 2: 88,973,466 I142V probably benign Het
Gm9774 G A 3: 92,428,357 A346V probably damaging Het
Gpam A C 19: 55,079,260 S484A probably damaging Het
Hectd2 T A 19: 36,618,751 N745K probably damaging Het
Hspa13 T C 16: 75,766,763 probably benign Het
Ints2 A G 11: 86,242,947 F426L probably benign Het
Ism1 A G 2: 139,678,721 T18A probably damaging Het
Itih2 T A 2: 10,102,805 Q650L probably benign Het
Jmjd4 T C 11: 59,450,393 F50S probably damaging Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Lrfn1 A G 7: 28,466,836 I552V probably damaging Het
Mcph1 A G 8: 18,632,170 E441G probably damaging Het
Mdn1 T A 4: 32,716,371 H2144Q possibly damaging Het
Mms19 A G 19: 41,966,313 S56P probably benign Het
Mrgprb3 A G 7: 48,643,368 I145T probably benign Het
Myh11 G A 16: 14,244,855 T287I probably damaging Het
Npas2 A G 1: 39,359,713 T730A probably benign Het
Olfr1229 G A 2: 89,282,353 P281L probably damaging Het
Pcdhgb1 A G 18: 37,682,169 E571G possibly damaging Het
Pcx T A 19: 4,619,167 V731E possibly damaging Het
Pgm1 T A 5: 64,112,038 Y489* probably null Het
Rrp12 T C 19: 41,880,417 T541A probably benign Het
Ryr3 C T 2: 112,900,984 W660* probably null Het
Sertad2 T A 11: 20,648,061 F86I possibly damaging Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc22a22 G T 15: 57,259,151 F143L probably benign Het
Slc22a28 C T 19: 8,071,011 V424I probably benign Het
Slc7a11 T G 3: 50,438,875 K106N probably damaging Het
Smgc A T 15: 91,844,420 D121V probably damaging Het
Sphk1 C T 11: 116,536,366 probably benign Het
Spock3 A T 8: 63,144,006 T118S probably benign Het
Stk17b G T 1: 53,771,784 S54* probably null Het
Sycp2 A G 2: 178,381,918 I435T probably benign Het
Tm2d3 G T 7: 65,701,618 D207Y probably damaging Het
Top2b A T 14: 16,387,280 N123Y probably damaging Het
Unc80 A G 1: 66,638,043 T2044A possibly damaging Het
Usp6nl A G 2: 6,440,432 S407G probably benign Het
Vmn1r195 G A 13: 22,278,389 V10I probably benign Het
Zfp292 C T 4: 34,811,703 R447H probably damaging Het
Other mutations in Kif5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Kif5b APN 18 6226973 splice site probably benign
IGL01697:Kif5b APN 18 6226871 missense possibly damaging 0.68
IGL01759:Kif5b APN 18 6225647 missense probably damaging 0.99
IGL01759:Kif5b APN 18 6211019 unclassified probably benign
IGL02027:Kif5b APN 18 6209089 missense possibly damaging 0.81
IGL02553:Kif5b APN 18 6220914 missense probably benign 0.00
IGL03327:Kif5b APN 18 6222767 missense probably damaging 0.96
IGL03346:Kif5b APN 18 6222767 missense probably damaging 0.96
e-enhancer UTSW 18 6213272 missense probably benign 0.00
R0440:Kif5b UTSW 18 6226980 splice site probably benign
R0743:Kif5b UTSW 18 6209192 missense probably damaging 1.00
R1241:Kif5b UTSW 18 6214044 missense probably benign 0.07
R1386:Kif5b UTSW 18 6226383 missense probably damaging 0.99
R1720:Kif5b UTSW 18 6213427 missense probably benign
R1964:Kif5b UTSW 18 6209059 missense possibly damaging 0.85
R2061:Kif5b UTSW 18 6226377 splice site probably null
R2091:Kif5b UTSW 18 6213248 nonsense probably null
R4510:Kif5b UTSW 18 6214011 missense probably benign 0.01
R4511:Kif5b UTSW 18 6214011 missense probably benign 0.01
R4515:Kif5b UTSW 18 6208257 missense probably benign
R4517:Kif5b UTSW 18 6213272 missense probably benign 0.00
R4690:Kif5b UTSW 18 6216759 missense probably benign
R4838:Kif5b UTSW 18 6216869 missense probably damaging 1.00
R4865:Kif5b UTSW 18 6222912 intron probably benign
R4906:Kif5b UTSW 18 6220930 missense probably benign 0.00
R5260:Kif5b UTSW 18 6211058 missense probably damaging 1.00
R5290:Kif5b UTSW 18 6234882 missense probably damaging 1.00
R5517:Kif5b UTSW 18 6220954 missense probably benign 0.00
R5588:Kif5b UTSW 18 6225787 missense probably benign 0.03
R6269:Kif5b UTSW 18 6223558 missense possibly damaging 0.88
R6377:Kif5b UTSW 18 6212562 missense probably damaging 1.00
R6955:Kif5b UTSW 18 6211070 missense probably benign 0.09
R7256:Kif5b UTSW 18 6225340 missense probably damaging 0.99
R7536:Kif5b UTSW 18 6216235 missense probably benign 0.05
R7892:Kif5b UTSW 18 6212517 missense probably benign 0.02
R7962:Kif5b UTSW 18 6241040 missense probably benign 0.02
R8238:Kif5b UTSW 18 6227619 missense probably damaging 1.00
R8444:Kif5b UTSW 18 6213245 missense probably benign 0.00
R8464:Kif5b UTSW 18 6225381 missense probably damaging 1.00
R8670:Kif5b UTSW 18 6214631 missense probably benign 0.01
R8691:Kif5b UTSW 18 6225787 missense probably benign 0.38
R8796:Kif5b UTSW 18 6226965 missense probably benign 0.01
R8897:Kif5b UTSW 18 6225437 missense probably damaging 1.00
R8989:Kif5b UTSW 18 6209021 missense probably damaging 0.98
R9003:Kif5b UTSW 18 6224047 missense probably benign 0.33
R9015:Kif5b UTSW 18 6216892 missense probably damaging 0.99
R9047:Kif5b UTSW 18 6208261 missense probably benign
R9369:Kif5b UTSW 18 6223584 missense probably damaging 1.00
R9622:Kif5b UTSW 18 6225672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTGGGAATCTTGAAGCT -3'
(R):5'- ACCCAGTCACAATGCTTATCC -3'

Sequencing Primer
(F):5'- TCTAAGAACAGACTTAGCTTACCCTG -3'
(R):5'- CTATGCAGGGTAAACTTCAT -3'
Posted On 2016-11-08