Incidental Mutation 'R5621:Hectd2'
ID 441592
Institutional Source Beutler Lab
Gene Symbol Hectd2
Ensembl Gene ENSMUSG00000041180
Gene Name HECT domain E3 ubiquitin protein ligase 2
Synonyms A630025O09Rik
MMRRC Submission 043279-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5621 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 36554639-36621135 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 36618751 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 745 (N745K)
Ref Sequence ENSEMBL: ENSMUSP00000128387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047247] [ENSMUST00000139215] [ENSMUST00000169036] [ENSMUST00000177381]
AlphaFold Q8CDU6
Predicted Effect probably damaging
Transcript: ENSMUST00000047247
AA Change: N744K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042646
Gene: ENSMUSG00000041180
AA Change: N744K

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 55 65 N/A INTRINSIC
low complexity region 109 128 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
HECTc 433 774 1.33e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129953
Predicted Effect probably benign
Transcript: ENSMUST00000139215
SMART Domains Protein: ENSMUSP00000117273
Gene: ENSMUSG00000041180

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 55 65 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149601
Predicted Effect probably benign
Transcript: ENSMUST00000155594
SMART Domains Protein: ENSMUSP00000120791
Gene: ENSMUSG00000041180

DomainStartEndE-ValueType
low complexity region 28 38 N/A INTRINSIC
low complexity region 82 101 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 287 300 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169036
AA Change: N745K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128387
Gene: ENSMUSG00000041180
AA Change: N745K

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 55 65 N/A INTRINSIC
low complexity region 109 128 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
HECTc 434 775 1.33e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177381
SMART Domains Protein: ENSMUSP00000134964
Gene: ENSMUSG00000041180

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
low complexity region 131 144 N/A INTRINSIC
Meta Mutation Damage Score 0.8715 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T G 17: 84,695,993 L417R probably damaging Het
Als2 A G 1: 59,191,890 V854A probably benign Het
Bbox1 C T 2: 110,292,523 W140* probably null Het
Ccdc28a A T 10: 18,216,268 N110K probably benign Het
Chrna6 C T 8: 27,407,040 E270K probably damaging Het
Cilp A G 9: 65,278,791 K723E possibly damaging Het
Ciz1 C A 2: 32,371,741 A455E probably damaging Het
Csmd3 T G 15: 48,313,978 H388P possibly damaging Het
Dnajc8 A G 4: 132,553,252 probably benign Het
Dnase1 G T 16: 4,039,118 C164F probably benign Het
Dync2h1 A T 9: 7,120,909 I2126K possibly damaging Het
Epha4 G T 1: 77,515,049 probably benign Het
Fer1l6 T C 15: 58,558,326 C201R probably damaging Het
Fgf8 T C 19: 45,742,382 Y68C probably benign Het
Gabrb1 A T 5: 72,108,728 I243F probably damaging Het
Gm13762 T C 2: 88,973,466 I142V probably benign Het
Gm9774 G A 3: 92,428,357 A346V probably damaging Het
Gpam A C 19: 55,079,260 S484A probably damaging Het
Hspa13 T C 16: 75,766,763 probably benign Het
Ints2 A G 11: 86,242,947 F426L probably benign Het
Ism1 A G 2: 139,678,721 T18A probably damaging Het
Itih2 T A 2: 10,102,805 Q650L probably benign Het
Jmjd4 T C 11: 59,450,393 F50S probably damaging Het
Kif5b T C 18: 6,226,883 N125S probably benign Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Lrfn1 A G 7: 28,466,836 I552V probably damaging Het
Mcph1 A G 8: 18,632,170 E441G probably damaging Het
Mdn1 T A 4: 32,716,371 H2144Q possibly damaging Het
Mms19 A G 19: 41,966,313 S56P probably benign Het
Mrgprb3 A G 7: 48,643,368 I145T probably benign Het
Myh11 G A 16: 14,244,855 T287I probably damaging Het
Npas2 A G 1: 39,359,713 T730A probably benign Het
Olfr1229 G A 2: 89,282,353 P281L probably damaging Het
Pcdhgb1 A G 18: 37,682,169 E571G possibly damaging Het
Pcx T A 19: 4,619,167 V731E possibly damaging Het
Pgm1 T A 5: 64,112,038 Y489* probably null Het
Rrp12 T C 19: 41,880,417 T541A probably benign Het
Ryr3 C T 2: 112,900,984 W660* probably null Het
Sertad2 T A 11: 20,648,061 F86I possibly damaging Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc22a22 G T 15: 57,259,151 F143L probably benign Het
Slc22a28 C T 19: 8,071,011 V424I probably benign Het
Slc7a11 T G 3: 50,438,875 K106N probably damaging Het
Smgc A T 15: 91,844,420 D121V probably damaging Het
Sphk1 C T 11: 116,536,366 probably benign Het
Spock3 A T 8: 63,144,006 T118S probably benign Het
Stk17b G T 1: 53,771,784 S54* probably null Het
Sycp2 A G 2: 178,381,918 I435T probably benign Het
Tm2d3 G T 7: 65,701,618 D207Y probably damaging Het
Top2b A T 14: 16,387,280 N123Y probably damaging Het
Unc80 A G 1: 66,638,043 T2044A possibly damaging Het
Usp6nl A G 2: 6,440,432 S407G probably benign Het
Vmn1r195 G A 13: 22,278,389 V10I probably benign Het
Zfp292 C T 4: 34,811,703 R447H probably damaging Het
Other mutations in Hectd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Hectd2 APN 19 36584936 missense probably benign
IGL01024:Hectd2 APN 19 36606393 missense probably damaging 1.00
IGL01111:Hectd2 APN 19 36597120 missense probably damaging 1.00
IGL01301:Hectd2 APN 19 36569370 splice site probably benign
IGL02019:Hectd2 APN 19 36615516 missense possibly damaging 0.94
IGL02410:Hectd2 APN 19 36595213 nonsense probably null
IGL02793:Hectd2 APN 19 36587421 missense probably damaging 0.99
IGL03010:Hectd2 APN 19 36615602 missense probably benign 0.01
IGL03115:Hectd2 APN 19 36599721 critical splice donor site probably null
IGL03251:Hectd2 APN 19 36585526 missense probably damaging 1.00
chopstix1 UTSW 19 36609416 missense possibly damaging 0.75
Chopstix3 UTSW 19 36615508 nonsense probably null
R0402:Hectd2 UTSW 19 36601529 critical splice donor site probably null
R0415:Hectd2 UTSW 19 36584884 unclassified probably benign
R0576:Hectd2 UTSW 19 36585497 missense probably benign
R0685:Hectd2 UTSW 19 36569431 missense probably damaging 0.99
R1460:Hectd2 UTSW 19 36615508 nonsense probably null
R1791:Hectd2 UTSW 19 36609416 missense possibly damaging 0.75
R1895:Hectd2 UTSW 19 36614460 missense probably damaging 1.00
R1928:Hectd2 UTSW 19 36612319 missense probably damaging 1.00
R2116:Hectd2 UTSW 19 36614424 missense probably damaging 0.99
R2520:Hectd2 UTSW 19 36612233 critical splice donor site probably null
R4693:Hectd2 UTSW 19 36614338 splice site probably benign
R4858:Hectd2 UTSW 19 36605282 missense probably damaging 0.98
R4943:Hectd2 UTSW 19 36604247 splice site probably null
R5031:Hectd2 UTSW 19 36599604 missense probably damaging 1.00
R5408:Hectd2 UTSW 19 36554896 missense possibly damaging 0.46
R5652:Hectd2 UTSW 19 36604320 missense probably damaging 1.00
R5704:Hectd2 UTSW 19 36598891 missense possibly damaging 0.93
R5950:Hectd2 UTSW 19 36597239 intron probably benign
R6414:Hectd2 UTSW 19 36618786 missense probably benign 0.21
R6438:Hectd2 UTSW 19 36618842 makesense probably null
R6544:Hectd2 UTSW 19 36612328 missense probably damaging 1.00
R6545:Hectd2 UTSW 19 36587378 missense probably benign 0.35
R6629:Hectd2 UTSW 19 36615538 missense probably damaging 1.00
R6672:Hectd2 UTSW 19 36587380 missense probably damaging 1.00
R6741:Hectd2 UTSW 19 36612359 missense probably damaging 1.00
R7117:Hectd2 UTSW 19 36599655 missense probably benign 0.29
R7238:Hectd2 UTSW 19 36597078 missense probably damaging 0.98
R7555:Hectd2 UTSW 19 36612403 missense probably damaging 1.00
R8184:Hectd2 UTSW 19 36604354 missense possibly damaging 0.83
R9069:Hectd2 UTSW 19 36585462 missense probably benign 0.00
R9149:Hectd2 UTSW 19 36599002 missense probably damaging 0.99
R9418:Hectd2 UTSW 19 36612174 missense probably benign 0.01
R9514:Hectd2 UTSW 19 36605289 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TCCTGCTGTTATCTAGAATGGCAC -3'
(R):5'- CCTCATTGTTTTAAAAGTGGTGAGC -3'

Sequencing Primer
(F):5'- GAATGGCACTTGATCCTAAGTTCTC -3'
(R):5'- GAGCTTTGAGAAAGTGTTTTGAAAC -3'
Posted On 2016-11-08