Incidental Mutation 'R5622:Flg2'
ID441610
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Namefilaggrin family member 2
SynonymsEG229574
MMRRC Submission 043161-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5622 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location93197278-93221391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 93202564 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 633 (H633P)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884] [ENSMUST00000194707]
Predicted Effect unknown
Transcript: ENSMUST00000098884
AA Change: H633P
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: H633P

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194707
SMART Domains Protein: ENSMUSP00000141201
Gene: ENSMUSG00000049133

DomainStartEndE-ValueType
SCOP:d1qlka_ 1 35 6e-10 SMART
low complexity region 53 64 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (69/71)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,327,668 S320T probably benign Het
Alg8 T A 7: 97,386,799 probably benign Het
Anp32b G A 4: 46,469,930 E202K unknown Het
Apcdd1 A G 18: 62,936,902 probably null Het
Apobec2 A G 17: 48,423,416 V74A possibly damaging Het
Arid3c A T 4: 41,729,959 C79S probably benign Het
Atp1a2 A T 1: 172,291,427 probably benign Het
B2m A T 2: 122,150,990 N62I probably damaging Het
Borcs5 T C 6: 134,686,123 probably null Het
Cdk11b A G 4: 155,630,217 K127E probably damaging Het
Cep170 T C 1: 176,735,867 H726R possibly damaging Het
Col5a2 A C 1: 45,427,059 S190A probably benign Het
Cryba4 T C 5: 112,251,124 D5G probably damaging Het
Cyp2a5 T G 7: 26,835,874 V87G probably damaging Het
Cyr61 A G 3: 145,649,320 L60P probably damaging Het
Dcaf8 A G 1: 172,186,398 probably benign Het
Dchs1 A G 7: 105,755,293 S2681P probably benign Het
Ddx20 A G 3: 105,679,011 S673P probably damaging Het
Deptor T A 15: 55,181,032 I198N probably damaging Het
Ebf2 T C 14: 67,390,558 I334T possibly damaging Het
F5 A G 1: 164,192,565 R870G probably benign Het
Gm11938 T A 11: 99,603,293 probably null Het
Gm5771 A C 6: 41,396,150 N119H probably damaging Het
Gm6370 A G 5: 146,493,898 T298A probably benign Het
Gm9825 C T 6: 7,982,605 noncoding transcript Het
H60b C A 10: 22,283,542 probably benign Het
Hsbp1 A G 8: 119,344,585 T4A possibly damaging Het
Hsd3b3 A T 3: 98,742,208 D266E possibly damaging Het
Ift172 T C 5: 31,283,082 Y287C probably damaging Het
Il20rb T A 9: 100,486,318 Q4L probably benign Het
Krt5 T C 15: 101,709,035 D421G probably damaging Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Me3 A G 7: 89,796,663 D196G probably damaging Het
Mfsd12 T A 10: 81,363,627 V451E probably null Het
Mib1 A G 18: 10,794,503 N663S possibly damaging Het
Mtus2 A T 5: 148,078,434 N679I probably benign Het
Myt1 A G 2: 181,797,122 T146A probably benign Het
Neb T A 2: 52,270,269 H2244L probably damaging Het
Olfr1444 A C 19: 12,862,299 I175L probably benign Het
Olfr510 C T 7: 108,668,082 T222I probably benign Het
Olfr630 T C 7: 103,755,169 T139A probably damaging Het
Pabpc4 A G 4: 123,291,731 probably null Het
Padi1 C A 4: 140,824,955 V393L probably damaging Het
Pax2 A T 19: 44,818,466 D300V probably damaging Het
Pcgf2 T C 11: 97,690,252 E71G probably damaging Het
Pi4kb A G 3: 94,998,861 Q573R possibly damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pkd1 A G 17: 24,574,040 E1567G possibly damaging Het
Plcb2 A T 2: 118,714,729 S630R probably damaging Het
Prrt2 A T 7: 127,019,765 V176D probably benign Het
Prss42 T C 9: 110,799,422 probably null Het
Rhoq A G 17: 86,997,031 R197G probably benign Het
Rin2 A T 2: 145,860,379 T332S probably benign Het
Rp1 A T 1: 4,347,837 N1017K possibly damaging Het
Setbp1 T A 18: 78,857,485 Y989F probably damaging Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc35f5 G A 1: 125,589,956 R497Q probably damaging Het
Slf1 T C 13: 77,049,971 K728R probably benign Het
Tiparp T G 3: 65,547,525 S364A probably benign Het
Tph1 G A 7: 46,647,545 Q409* probably null Het
Trp73 A T 4: 154,060,592 I526N possibly damaging Het
Ttc9c G A 19: 8,815,968 R103* probably null Het
Vmn2r75 T A 7: 86,148,494 I704F probably benign Het
Wdr76 A G 2: 121,517,735 R63G probably damaging Het
Zc3h3 T A 15: 75,777,079 S735C probably damaging Het
Zfp383 G A 7: 29,912,190 V32M probably damaging Het
Zfp810 T A 9: 22,279,096 Y172F probably benign Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
R8078:Flg2 UTSW 3 93200275 missense probably damaging 1.00
R8142:Flg2 UTSW 3 93215475 nonsense probably null
R8156:Flg2 UTSW 3 93220083 missense unknown
R8172:Flg2 UTSW 3 93201161 missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93202767 missense unknown
R8262:Flg2 UTSW 3 93220210 missense unknown
R8269:Flg2 UTSW 3 93201880 missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93202762 missense unknown
R8444:Flg2 UTSW 3 93200278 missense probably damaging 0.97
R8670:Flg2 UTSW 3 93201484 missense probably damaging 0.97
R8755:Flg2 UTSW 3 93200813 missense probably damaging 1.00
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTGGGAAGCATGAGACTGG -3'
(R):5'- TTGCCCAAAGCCAGATGACTG -3'

Sequencing Primer
(F):5'- TGGACCCAGTCAGTCATCTAG -3'
(R):5'- AGATGACTGACCTGAGCCTGTC -3'
Posted On2016-11-08