Incidental Mutation 'R5622:Pabpc4'
ID441617
Institutional Source Beutler Lab
Gene Symbol Pabpc4
Ensembl Gene ENSMUSG00000011257
Gene Namepoly(A) binding protein, cytoplasmic 4
Synonyms
MMRRC Submission 043161-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5622 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location123262351-123298925 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 123291731 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078734] [ENSMUST00000078734] [ENSMUST00000078734] [ENSMUST00000078734] [ENSMUST00000080178] [ENSMUST00000080178] [ENSMUST00000106241] [ENSMUST00000106241] [ENSMUST00000106241] [ENSMUST00000106241] [ENSMUST00000106243] [ENSMUST00000106243] [ENSMUST00000106243] [ENSMUST00000106243] [ENSMUST00000183940] [ENSMUST00000183940]
Predicted Effect probably null
Transcript: ENSMUST00000078734
SMART Domains Protein: ENSMUSP00000077794
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 478 493 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
PolyA 534 597 4.49e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000078734
SMART Domains Protein: ENSMUSP00000077794
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 478 493 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
PolyA 534 597 4.49e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000078734
SMART Domains Protein: ENSMUSP00000077794
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 478 493 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
PolyA 534 597 4.49e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000078734
SMART Domains Protein: ENSMUSP00000077794
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 478 493 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
PolyA 534 597 4.49e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000080178
SMART Domains Protein: ENSMUSP00000079070
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 523 538 N/A INTRINSIC
low complexity region 548 561 N/A INTRINSIC
PolyA 579 642 4.49e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000080178
SMART Domains Protein: ENSMUSP00000079070
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 523 538 N/A INTRINSIC
low complexity region 548 561 N/A INTRINSIC
PolyA 579 642 4.49e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083844
Predicted Effect probably null
Transcript: ENSMUST00000106241
SMART Domains Protein: ENSMUSP00000101848
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 507 522 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
PolyA 563 626 4.49e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106241
SMART Domains Protein: ENSMUSP00000101848
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 507 522 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
PolyA 563 626 4.49e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106241
SMART Domains Protein: ENSMUSP00000101848
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 507 522 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
PolyA 563 626 4.49e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106241
SMART Domains Protein: ENSMUSP00000101848
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 507 522 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
PolyA 563 626 4.49e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106243
SMART Domains Protein: ENSMUSP00000101850
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 6.2e-24 SMART
RRM 100 171 1.2e-27 SMART
RRM 192 264 5.4e-28 SMART
RRM 295 366 1e-27 SMART
low complexity region 494 509 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
PolyA 550 613 2.1e-43 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106243
SMART Domains Protein: ENSMUSP00000101850
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 6.2e-24 SMART
RRM 100 171 1.2e-27 SMART
RRM 192 264 5.4e-28 SMART
RRM 295 366 1e-27 SMART
low complexity region 494 509 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
PolyA 550 613 2.1e-43 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106243
SMART Domains Protein: ENSMUSP00000101850
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 6.2e-24 SMART
RRM 100 171 1.2e-27 SMART
RRM 192 264 5.4e-28 SMART
RRM 295 366 1e-27 SMART
low complexity region 494 509 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
PolyA 550 613 2.1e-43 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106243
SMART Domains Protein: ENSMUSP00000101850
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 6.2e-24 SMART
RRM 100 171 1.2e-27 SMART
RRM 192 264 5.4e-28 SMART
RRM 295 366 1e-27 SMART
low complexity region 494 509 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
PolyA 550 613 2.1e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156807
Predicted Effect probably benign
Transcript: ENSMUST00000183940
SMART Domains Protein: ENSMUSP00000139135
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 167 7.64e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183940
SMART Domains Protein: ENSMUSP00000139135
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 167 7.64e-20 SMART
Meta Mutation Damage Score 0.9590 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Poly(A)-binding proteins (PABPs) bind to the poly(A) tail present at the 3-prime ends of most eukaryotic mRNAs. PABPC4 or IPABP (inducible PABP) was isolated as an activation-induced T-cell mRNA encoding a protein. Activation of T cells increased PABPC4 mRNA levels in T cells approximately 5-fold. PABPC4 contains 4 RNA-binding domains and proline-rich C terminus. PABPC4 is localized primarily to the cytoplasm. It is suggested that PABPC4 might be necessary for regulation of stability of labile mRNA species in activated T cells. PABPC4 was also identified as an antigen, APP1 (activated-platelet protein-1), expressed on thrombin-activated rabbit platelets. PABPC4 may also be involved in the regulation of protein translation in platelets and megakaryocytes or may participate in the binding or stabilization of polyadenylates in platelet dense granules. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,327,668 S320T probably benign Het
Alg8 T A 7: 97,386,799 probably benign Het
Anp32b G A 4: 46,469,930 E202K unknown Het
Apcdd1 A G 18: 62,936,902 probably null Het
Apobec2 A G 17: 48,423,416 V74A possibly damaging Het
Arid3c A T 4: 41,729,959 C79S probably benign Het
Atp1a2 A T 1: 172,291,427 probably benign Het
B2m A T 2: 122,150,990 N62I probably damaging Het
Borcs5 T C 6: 134,686,123 probably null Het
Cdk11b A G 4: 155,630,217 K127E probably damaging Het
Cep170 T C 1: 176,735,867 H726R possibly damaging Het
Col5a2 A C 1: 45,427,059 S190A probably benign Het
Cryba4 T C 5: 112,251,124 D5G probably damaging Het
Cyp2a5 T G 7: 26,835,874 V87G probably damaging Het
Cyr61 A G 3: 145,649,320 L60P probably damaging Het
Dcaf8 A G 1: 172,186,398 probably benign Het
Dchs1 A G 7: 105,755,293 S2681P probably benign Het
Ddx20 A G 3: 105,679,011 S673P probably damaging Het
Deptor T A 15: 55,181,032 I198N probably damaging Het
Ebf2 T C 14: 67,390,558 I334T possibly damaging Het
F5 A G 1: 164,192,565 R870G probably benign Het
Flg2 A C 3: 93,202,564 H633P unknown Het
Gm11938 T A 11: 99,603,293 probably null Het
Gm5771 A C 6: 41,396,150 N119H probably damaging Het
Gm6370 A G 5: 146,493,898 T298A probably benign Het
Gm9825 C T 6: 7,982,605 noncoding transcript Het
H60b C A 10: 22,283,542 probably benign Het
Hsbp1 A G 8: 119,344,585 T4A possibly damaging Het
Hsd3b3 A T 3: 98,742,208 D266E possibly damaging Het
Ift172 T C 5: 31,283,082 Y287C probably damaging Het
Il20rb T A 9: 100,486,318 Q4L probably benign Het
Krt5 T C 15: 101,709,035 D421G probably damaging Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Me3 A G 7: 89,796,663 D196G probably damaging Het
Mfsd12 T A 10: 81,363,627 V451E probably null Het
Mib1 A G 18: 10,794,503 N663S possibly damaging Het
Mtus2 A T 5: 148,078,434 N679I probably benign Het
Myt1 A G 2: 181,797,122 T146A probably benign Het
Neb T A 2: 52,270,269 H2244L probably damaging Het
Olfr1444 A C 19: 12,862,299 I175L probably benign Het
Olfr510 C T 7: 108,668,082 T222I probably benign Het
Olfr630 T C 7: 103,755,169 T139A probably damaging Het
Padi1 C A 4: 140,824,955 V393L probably damaging Het
Pax2 A T 19: 44,818,466 D300V probably damaging Het
Pcgf2 T C 11: 97,690,252 E71G probably damaging Het
Pi4kb A G 3: 94,998,861 Q573R possibly damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pkd1 A G 17: 24,574,040 E1567G possibly damaging Het
Plcb2 A T 2: 118,714,729 S630R probably damaging Het
Prrt2 A T 7: 127,019,765 V176D probably benign Het
Prss42 T C 9: 110,799,422 probably null Het
Rhoq A G 17: 86,997,031 R197G probably benign Het
Rin2 A T 2: 145,860,379 T332S probably benign Het
Rp1 A T 1: 4,347,837 N1017K possibly damaging Het
Setbp1 T A 18: 78,857,485 Y989F probably damaging Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc35f5 G A 1: 125,589,956 R497Q probably damaging Het
Slf1 T C 13: 77,049,971 K728R probably benign Het
Tiparp T G 3: 65,547,525 S364A probably benign Het
Tph1 G A 7: 46,647,545 Q409* probably null Het
Trp73 A T 4: 154,060,592 I526N possibly damaging Het
Ttc9c G A 19: 8,815,968 R103* probably null Het
Vmn2r75 T A 7: 86,148,494 I704F probably benign Het
Wdr76 A G 2: 121,517,735 R63G probably damaging Het
Zc3h3 T A 15: 75,777,079 S735C probably damaging Het
Zfp383 G A 7: 29,912,190 V32M probably damaging Het
Zfp810 T A 9: 22,279,096 Y172F probably benign Het
Other mutations in Pabpc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Pabpc4 APN 4 123286704 missense probably damaging 1.00
IGL00970:Pabpc4 APN 4 123286815 missense probably damaging 1.00
IGL03093:Pabpc4 APN 4 123286709 missense probably damaging 0.96
R0383:Pabpc4 UTSW 4 123297942 missense probably damaging 1.00
R0924:Pabpc4 UTSW 4 123294665 missense possibly damaging 0.56
R1076:Pabpc4 UTSW 4 123292908 missense possibly damaging 0.74
R1381:Pabpc4 UTSW 4 123289059 missense probably damaging 1.00
R1908:Pabpc4 UTSW 4 123289068 missense possibly damaging 0.68
R1957:Pabpc4 UTSW 4 123286865 missense probably damaging 1.00
R2324:Pabpc4 UTSW 4 123297778 splice site probably benign
R2567:Pabpc4 UTSW 4 123297951 missense probably damaging 1.00
R3768:Pabpc4 UTSW 4 123294612 missense probably damaging 1.00
R4350:Pabpc4 UTSW 4 123290267 missense probably damaging 1.00
R4352:Pabpc4 UTSW 4 123290267 missense probably damaging 1.00
R4353:Pabpc4 UTSW 4 123290267 missense probably damaging 1.00
R5304:Pabpc4 UTSW 4 123290307 missense probably benign 0.43
R5386:Pabpc4 UTSW 4 123294997 missense probably benign 0.15
R6853:Pabpc4 UTSW 4 123294743 missense possibly damaging 0.60
R7558:Pabpc4 UTSW 4 123294620 missense possibly damaging 0.94
R7602:Pabpc4 UTSW 4 123292892 missense possibly damaging 0.59
R7631:Pabpc4 UTSW 4 123288970 missense probably damaging 0.96
R7714:Pabpc4 UTSW 4 123295309 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGAAGATGTGTCTGGGC -3'
(R):5'- TAAGATACCACAGGCACGTC -3'

Sequencing Primer
(F):5'- AAGATGTGTCTGGGCCAGTAACTC -3'
(R):5'- GATACCACAGGCACGTCAAACATTC -3'
Posted On2016-11-08