Incidental Mutation 'R5622:Cryba4'
ID441622
Institutional Source Beutler Lab
Gene Symbol Cryba4
Ensembl Gene ENSMUSG00000066975
Gene Namecrystallin, beta A4
Synonyms
MMRRC Submission 043161-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5622 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location112246493-112252518 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112251124 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 5 (D5G)
Ref Sequence ENSEMBL: ENSMUSP00000108002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031286] [ENSMUST00000086629] [ENSMUST00000112375] [ENSMUST00000112383] [ENSMUST00000112385] [ENSMUST00000131673]
Predicted Effect probably benign
Transcript: ENSMUST00000031286
SMART Domains Protein: ENSMUSP00000031286
Gene: ENSMUSG00000029343

DomainStartEndE-ValueType
low complexity region 19 47 N/A INTRINSIC
XTALbg 58 140 9.71e-40 SMART
XTALbg 148 230 5.8e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086629
AA Change: D18G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083826
Gene: ENSMUSG00000066975
AA Change: D18G

DomainStartEndE-ValueType
XTALbg 13 97 1.08e-37 SMART
XTALbg 106 194 2.59e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112375
SMART Domains Protein: ENSMUSP00000107994
Gene: ENSMUSG00000029343

DomainStartEndE-ValueType
low complexity region 19 47 N/A INTRINSIC
XTALbg 58 140 9.71e-40 SMART
XTALbg 148 230 5.8e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112383
AA Change: D5G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108002
Gene: ENSMUSG00000066975
AA Change: D5G

DomainStartEndE-ValueType
XTALbg 1 84 1.71e-35 SMART
XTALbg 93 181 2.59e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112385
AA Change: D18G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108004
Gene: ENSMUSG00000066975
AA Change: D18G

DomainStartEndE-ValueType
XTALbg 13 97 1.08e-37 SMART
XTALbg 106 194 2.59e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131673
SMART Domains Protein: ENSMUSP00000118399
Gene: ENSMUSG00000029343

DomainStartEndE-ValueType
low complexity region 19 47 N/A INTRINSIC
XTALbg 58 140 9.71e-40 SMART
XTALbg 148 230 5.8e-38 SMART
Meta Mutation Damage Score 0.9465 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: This gene encodes a member of the crystallin family of proteins that contribute to the transparency and refractive properties of the ocular lens. Certain mutations in the human ortholog of this gene are associated with cataract and bilateral microphthalmia. This gene is located adjacent to a related crystallin gene on chromosome 5. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,327,668 S320T probably benign Het
Alg8 T A 7: 97,386,799 probably benign Het
Anp32b G A 4: 46,469,930 E202K unknown Het
Apcdd1 A G 18: 62,936,902 probably null Het
Apobec2 A G 17: 48,423,416 V74A possibly damaging Het
Arid3c A T 4: 41,729,959 C79S probably benign Het
Atp1a2 A T 1: 172,291,427 probably benign Het
B2m A T 2: 122,150,990 N62I probably damaging Het
Borcs5 T C 6: 134,686,123 probably null Het
Cdk11b A G 4: 155,630,217 K127E probably damaging Het
Cep170 T C 1: 176,735,867 H726R possibly damaging Het
Col5a2 A C 1: 45,427,059 S190A probably benign Het
Cyp2a5 T G 7: 26,835,874 V87G probably damaging Het
Cyr61 A G 3: 145,649,320 L60P probably damaging Het
Dcaf8 A G 1: 172,186,398 probably benign Het
Dchs1 A G 7: 105,755,293 S2681P probably benign Het
Ddx20 A G 3: 105,679,011 S673P probably damaging Het
Deptor T A 15: 55,181,032 I198N probably damaging Het
Ebf2 T C 14: 67,390,558 I334T possibly damaging Het
F5 A G 1: 164,192,565 R870G probably benign Het
Flg2 A C 3: 93,202,564 H633P unknown Het
Gm11938 T A 11: 99,603,293 probably null Het
Gm5771 A C 6: 41,396,150 N119H probably damaging Het
Gm6370 A G 5: 146,493,898 T298A probably benign Het
Gm9825 C T 6: 7,982,605 noncoding transcript Het
H60b C A 10: 22,283,542 probably benign Het
Hsbp1 A G 8: 119,344,585 T4A possibly damaging Het
Hsd3b3 A T 3: 98,742,208 D266E possibly damaging Het
Ift172 T C 5: 31,283,082 Y287C probably damaging Het
Il20rb T A 9: 100,486,318 Q4L probably benign Het
Krt5 T C 15: 101,709,035 D421G probably damaging Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Me3 A G 7: 89,796,663 D196G probably damaging Het
Mfsd12 T A 10: 81,363,627 V451E probably null Het
Mib1 A G 18: 10,794,503 N663S possibly damaging Het
Mtus2 A T 5: 148,078,434 N679I probably benign Het
Myt1 A G 2: 181,797,122 T146A probably benign Het
Neb T A 2: 52,270,269 H2244L probably damaging Het
Olfr1444 A C 19: 12,862,299 I175L probably benign Het
Olfr510 C T 7: 108,668,082 T222I probably benign Het
Olfr630 T C 7: 103,755,169 T139A probably damaging Het
Pabpc4 A G 4: 123,291,731 probably null Het
Padi1 C A 4: 140,824,955 V393L probably damaging Het
Pax2 A T 19: 44,818,466 D300V probably damaging Het
Pcgf2 T C 11: 97,690,252 E71G probably damaging Het
Pi4kb A G 3: 94,998,861 Q573R possibly damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pkd1 A G 17: 24,574,040 E1567G possibly damaging Het
Plcb2 A T 2: 118,714,729 S630R probably damaging Het
Prrt2 A T 7: 127,019,765 V176D probably benign Het
Prss42 T C 9: 110,799,422 probably null Het
Rhoq A G 17: 86,997,031 R197G probably benign Het
Rin2 A T 2: 145,860,379 T332S probably benign Het
Rp1 A T 1: 4,347,837 N1017K possibly damaging Het
Setbp1 T A 18: 78,857,485 Y989F probably damaging Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc35f5 G A 1: 125,589,956 R497Q probably damaging Het
Slf1 T C 13: 77,049,971 K728R probably benign Het
Tiparp T G 3: 65,547,525 S364A probably benign Het
Tph1 G A 7: 46,647,545 Q409* probably null Het
Trp73 A T 4: 154,060,592 I526N possibly damaging Het
Ttc9c G A 19: 8,815,968 R103* probably null Het
Vmn2r75 T A 7: 86,148,494 I704F probably benign Het
Wdr76 A G 2: 121,517,735 R63G probably damaging Het
Zc3h3 T A 15: 75,777,079 S735C probably damaging Het
Zfp383 G A 7: 29,912,190 V32M probably damaging Het
Zfp810 T A 9: 22,279,096 Y172F probably benign Het
Other mutations in Cryba4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Cryba4 APN 5 112251009 unclassified probably benign
R0741:Cryba4 UTSW 5 112246688 missense probably damaging 1.00
R5811:Cryba4 UTSW 5 112251071 missense probably benign
R6644:Cryba4 UTSW 5 112246762 missense probably damaging 1.00
R7008:Cryba4 UTSW 5 112251782 missense probably benign
R7554:Cryba4 UTSW 5 112251103 missense probably damaging 0.99
R7556:Cryba4 UTSW 5 112251103 missense probably damaging 0.99
R7671:Cryba4 UTSW 5 112248173 critical splice donor site probably null
R7888:Cryba4 UTSW 5 112251052 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACAGTGCAAGCCTGGAAAG -3'
(R):5'- ATTGTGCTGTCCAGGATCCC -3'

Sequencing Primer
(F):5'- GATGTACCTAGGATCATACACAGGC -3'
(R):5'- GATCCCACGGTCCACCTTG -3'
Posted On2016-11-08