Incidental Mutation 'R5622:Krt5'
ID441651
Institutional Source Beutler Lab
Gene Symbol Krt5
Ensembl Gene ENSMUSG00000061527
Gene Namekeratin 5
SynonymsKrt2-5, Tfip8, 3300001P10Rik, K5
MMRRC Submission 043161-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5622 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101707070-101712898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101709035 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 421 (D421G)
Ref Sequence ENSEMBL: ENSMUSP00000023709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023709]
Predicted Effect probably damaging
Transcript: ENSMUST00000023709
AA Change: D421G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023709
Gene: ENSMUSG00000061527
AA Change: D421G

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 158 3.6e-44 PFAM
Filament 161 474 1.58e-174 SMART
low complexity region 483 577 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198689
Meta Mutation Damage Score 0.6458 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the basal layer of the epidermis with family member KRT14. Mutations in these genes have been associated with a complex of diseases termed epidermolysis bullosa simplex. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within the first hour after birth. They have a loose, fragile epidermal layer and abnormal epithelium in parts of the digestive tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,327,668 S320T probably benign Het
Alg8 T A 7: 97,386,799 probably benign Het
Anp32b G A 4: 46,469,930 E202K unknown Het
Apcdd1 A G 18: 62,936,902 probably null Het
Apobec2 A G 17: 48,423,416 V74A possibly damaging Het
Arid3c A T 4: 41,729,959 C79S probably benign Het
Atp1a2 A T 1: 172,291,427 probably benign Het
B2m A T 2: 122,150,990 N62I probably damaging Het
Borcs5 T C 6: 134,686,123 probably null Het
Cdk11b A G 4: 155,630,217 K127E probably damaging Het
Cep170 T C 1: 176,735,867 H726R possibly damaging Het
Col5a2 A C 1: 45,427,059 S190A probably benign Het
Cryba4 T C 5: 112,251,124 D5G probably damaging Het
Cyp2a5 T G 7: 26,835,874 V87G probably damaging Het
Cyr61 A G 3: 145,649,320 L60P probably damaging Het
Dcaf8 A G 1: 172,186,398 probably benign Het
Dchs1 A G 7: 105,755,293 S2681P probably benign Het
Ddx20 A G 3: 105,679,011 S673P probably damaging Het
Deptor T A 15: 55,181,032 I198N probably damaging Het
Ebf2 T C 14: 67,390,558 I334T possibly damaging Het
F5 A G 1: 164,192,565 R870G probably benign Het
Flg2 A C 3: 93,202,564 H633P unknown Het
Gm11938 T A 11: 99,603,293 probably null Het
Gm5771 A C 6: 41,396,150 N119H probably damaging Het
Gm6370 A G 5: 146,493,898 T298A probably benign Het
Gm9825 C T 6: 7,982,605 noncoding transcript Het
H60b C A 10: 22,283,542 probably benign Het
Hsbp1 A G 8: 119,344,585 T4A possibly damaging Het
Hsd3b3 A T 3: 98,742,208 D266E possibly damaging Het
Ift172 T C 5: 31,283,082 Y287C probably damaging Het
Il20rb T A 9: 100,486,318 Q4L probably benign Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Me3 A G 7: 89,796,663 D196G probably damaging Het
Mfsd12 T A 10: 81,363,627 V451E probably null Het
Mib1 A G 18: 10,794,503 N663S possibly damaging Het
Mtus2 A T 5: 148,078,434 N679I probably benign Het
Myt1 A G 2: 181,797,122 T146A probably benign Het
Neb T A 2: 52,270,269 H2244L probably damaging Het
Olfr1444 A C 19: 12,862,299 I175L probably benign Het
Olfr510 C T 7: 108,668,082 T222I probably benign Het
Olfr630 T C 7: 103,755,169 T139A probably damaging Het
Pabpc4 A G 4: 123,291,731 probably null Het
Padi1 C A 4: 140,824,955 V393L probably damaging Het
Pax2 A T 19: 44,818,466 D300V probably damaging Het
Pcgf2 T C 11: 97,690,252 E71G probably damaging Het
Pi4kb A G 3: 94,998,861 Q573R possibly damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pkd1 A G 17: 24,574,040 E1567G possibly damaging Het
Plcb2 A T 2: 118,714,729 S630R probably damaging Het
Prrt2 A T 7: 127,019,765 V176D probably benign Het
Prss42 T C 9: 110,799,422 probably null Het
Rhoq A G 17: 86,997,031 R197G probably benign Het
Rin2 A T 2: 145,860,379 T332S probably benign Het
Rp1 A T 1: 4,347,837 N1017K possibly damaging Het
Setbp1 T A 18: 78,857,485 Y989F probably damaging Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc35f5 G A 1: 125,589,956 R497Q probably damaging Het
Slf1 T C 13: 77,049,971 K728R probably benign Het
Tiparp T G 3: 65,547,525 S364A probably benign Het
Tph1 G A 7: 46,647,545 Q409* probably null Het
Trp73 A T 4: 154,060,592 I526N possibly damaging Het
Ttc9c G A 19: 8,815,968 R103* probably null Het
Vmn2r75 T A 7: 86,148,494 I704F probably benign Het
Wdr76 A G 2: 121,517,735 R63G probably damaging Het
Zc3h3 T A 15: 75,777,079 S735C probably damaging Het
Zfp383 G A 7: 29,912,190 V32M probably damaging Het
Zfp810 T A 9: 22,279,096 Y172F probably benign Het
Other mutations in Krt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Krt5 APN 15 101712641 missense unknown
IGL01949:Krt5 APN 15 101710613 missense probably benign 0.14
IGL03013:Krt5 APN 15 101711668 missense probably benign 0.00
IGL03286:Krt5 APN 15 101707548 missense unknown
R1598:Krt5 UTSW 15 101712441 missense probably benign 0.38
R1697:Krt5 UTSW 15 101710585 missense probably benign 0.06
R1967:Krt5 UTSW 15 101711659 missense probably benign 0.21
R2143:Krt5 UTSW 15 101712359 missense probably damaging 1.00
R2438:Krt5 UTSW 15 101711658 missense probably benign 0.10
R4633:Krt5 UTSW 15 101711607 missense probably damaging 0.98
R4771:Krt5 UTSW 15 101709059 missense probably damaging 0.99
R4918:Krt5 UTSW 15 101710307 missense probably damaging 1.00
R6797:Krt5 UTSW 15 101712641 missense unknown
R6873:Krt5 UTSW 15 101712877 start gained probably benign
R7808:Krt5 UTSW 15 101709018 missense probably benign 0.01
R8010:Krt5 UTSW 15 101712356 missense probably damaging 1.00
R8252:Krt5 UTSW 15 101712359 missense probably damaging 1.00
R8696:Krt5 UTSW 15 101710307 missense probably damaging 1.00
R8889:Krt5 UTSW 15 101710750 missense probably benign 0.01
R8892:Krt5 UTSW 15 101710750 missense probably benign 0.01
X0019:Krt5 UTSW 15 101712368 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTCTACATTCTGGAGGCCAC -3'
(R):5'- TCCACCACTCACATTAGATACTGAG -3'

Sequencing Primer
(F):5'- TCAAGCACACTACGGCCCTC -3'
(R):5'- ACTGAGTTCGTATACTGAGTTCTTTC -3'
Posted On2016-11-08