Incidental Mutation 'R5622:Lonp1'
ID441655
Institutional Source Beutler Lab
Gene Symbol Lonp1
Ensembl Gene ENSMUSG00000041168
Gene Namelon peptidase 1, mitochondrial
Synonyms1200017E13Rik, LON, Prss15
MMRRC Submission 043161-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5622 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56614301-56626903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 56620263 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 330 (A330G)
Ref Sequence ENSEMBL: ENSMUSP00000041814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047226]
Predicted Effect probably benign
Transcript: ENSMUST00000047226
AA Change: A330G

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000041814
Gene: ENSMUSG00000041168
AA Change: A330G

DomainStartEndE-ValueType
LON 111 357 3.95e-62 SMART
low complexity region 389 404 N/A INTRINSIC
AAA 504 649 1.81e-14 SMART
Pfam:Lon_C 725 938 1e-71 PFAM
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial matrix protein that belongs to the Lon family of ATP-dependent proteases. This protein mediates the selective degradation of misfolded, unassembled or oxidatively damaged polypeptides in the mitochondrial matrix. It may also have a chaperone function in the assembly of inner membrane protein complexes, and participate in the regulation of mitochondrial gene expression and maintenance of the integrity of the mitochondrial genome. Decreased expression of this gene has been noted in a patient with hereditary spastic paraplegia (PMID:18378094). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality with embryonic growth retardation, small size and decreased mitochondrial DNA content. Mice heterozygous for this allele exhibit reduced chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,327,668 S320T probably benign Het
Alg8 T A 7: 97,386,799 probably benign Het
Anp32b G A 4: 46,469,930 E202K unknown Het
Apcdd1 A G 18: 62,936,902 probably null Het
Apobec2 A G 17: 48,423,416 V74A possibly damaging Het
Arid3c A T 4: 41,729,959 C79S probably benign Het
Atp1a2 A T 1: 172,291,427 probably benign Het
B2m A T 2: 122,150,990 N62I probably damaging Het
Borcs5 T C 6: 134,686,123 probably null Het
Cdk11b A G 4: 155,630,217 K127E probably damaging Het
Cep170 T C 1: 176,735,867 H726R possibly damaging Het
Col5a2 A C 1: 45,427,059 S190A probably benign Het
Cryba4 T C 5: 112,251,124 D5G probably damaging Het
Cyp2a5 T G 7: 26,835,874 V87G probably damaging Het
Cyr61 A G 3: 145,649,320 L60P probably damaging Het
Dcaf8 A G 1: 172,186,398 probably benign Het
Dchs1 A G 7: 105,755,293 S2681P probably benign Het
Ddx20 A G 3: 105,679,011 S673P probably damaging Het
Deptor T A 15: 55,181,032 I198N probably damaging Het
Ebf2 T C 14: 67,390,558 I334T possibly damaging Het
F5 A G 1: 164,192,565 R870G probably benign Het
Flg2 A C 3: 93,202,564 H633P unknown Het
Gm11938 T A 11: 99,603,293 probably null Het
Gm5771 A C 6: 41,396,150 N119H probably damaging Het
Gm6370 A G 5: 146,493,898 T298A probably benign Het
Gm9825 C T 6: 7,982,605 noncoding transcript Het
H60b C A 10: 22,283,542 probably benign Het
Hsbp1 A G 8: 119,344,585 T4A possibly damaging Het
Hsd3b3 A T 3: 98,742,208 D266E possibly damaging Het
Ift172 T C 5: 31,283,082 Y287C probably damaging Het
Il20rb T A 9: 100,486,318 Q4L probably benign Het
Krt5 T C 15: 101,709,035 D421G probably damaging Het
Me3 A G 7: 89,796,663 D196G probably damaging Het
Mfsd12 T A 10: 81,363,627 V451E probably null Het
Mib1 A G 18: 10,794,503 N663S possibly damaging Het
Mtus2 A T 5: 148,078,434 N679I probably benign Het
Myt1 A G 2: 181,797,122 T146A probably benign Het
Neb T A 2: 52,270,269 H2244L probably damaging Het
Olfr1444 A C 19: 12,862,299 I175L probably benign Het
Olfr510 C T 7: 108,668,082 T222I probably benign Het
Olfr630 T C 7: 103,755,169 T139A probably damaging Het
Pabpc4 A G 4: 123,291,731 probably null Het
Padi1 C A 4: 140,824,955 V393L probably damaging Het
Pax2 A T 19: 44,818,466 D300V probably damaging Het
Pcgf2 T C 11: 97,690,252 E71G probably damaging Het
Pi4kb A G 3: 94,998,861 Q573R possibly damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pkd1 A G 17: 24,574,040 E1567G possibly damaging Het
Plcb2 A T 2: 118,714,729 S630R probably damaging Het
Prrt2 A T 7: 127,019,765 V176D probably benign Het
Prss42 T C 9: 110,799,422 probably null Het
Rhoq A G 17: 86,997,031 R197G probably benign Het
Rin2 A T 2: 145,860,379 T332S probably benign Het
Rp1 A T 1: 4,347,837 N1017K possibly damaging Het
Setbp1 T A 18: 78,857,485 Y989F probably damaging Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc35f5 G A 1: 125,589,956 R497Q probably damaging Het
Slf1 T C 13: 77,049,971 K728R probably benign Het
Tiparp T G 3: 65,547,525 S364A probably benign Het
Tph1 G A 7: 46,647,545 Q409* probably null Het
Trp73 A T 4: 154,060,592 I526N possibly damaging Het
Ttc9c G A 19: 8,815,968 R103* probably null Het
Vmn2r75 T A 7: 86,148,494 I704F probably benign Het
Wdr76 A G 2: 121,517,735 R63G probably damaging Het
Zc3h3 T A 15: 75,777,079 S735C probably damaging Het
Zfp383 G A 7: 29,912,190 V32M probably damaging Het
Zfp810 T A 9: 22,279,096 Y172F probably benign Het
Other mutations in Lonp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Lonp1 APN 17 56619265 missense probably damaging 1.00
IGL00934:Lonp1 APN 17 56614683 missense probably benign 0.21
IGL01065:Lonp1 APN 17 56615500 unclassified probably benign
IGL01343:Lonp1 APN 17 56615586 missense possibly damaging 0.93
IGL01734:Lonp1 APN 17 56616026 missense probably damaging 1.00
IGL02141:Lonp1 APN 17 56615086 missense probably benign 0.19
IGL02979:Lonp1 APN 17 56621940 missense probably benign 0.02
R0015:Lonp1 UTSW 17 56618406 missense probably benign
R0015:Lonp1 UTSW 17 56618406 missense probably benign
R0863:Lonp1 UTSW 17 56618331 missense probably damaging 1.00
R1343:Lonp1 UTSW 17 56620272 missense probably damaging 1.00
R1735:Lonp1 UTSW 17 56614956 missense probably damaging 1.00
R1975:Lonp1 UTSW 17 56615068 missense possibly damaging 0.69
R1976:Lonp1 UTSW 17 56615068 missense possibly damaging 0.69
R1977:Lonp1 UTSW 17 56615068 missense possibly damaging 0.69
R2484:Lonp1 UTSW 17 56614659 missense probably damaging 1.00
R2895:Lonp1 UTSW 17 56615562 missense probably damaging 1.00
R3123:Lonp1 UTSW 17 56626488 missense possibly damaging 0.79
R3125:Lonp1 UTSW 17 56626488 missense possibly damaging 0.79
R3429:Lonp1 UTSW 17 56618337 missense probably damaging 1.00
R3726:Lonp1 UTSW 17 56618310 unclassified probably benign
R3767:Lonp1 UTSW 17 56621952 missense possibly damaging 0.80
R4618:Lonp1 UTSW 17 56622511 missense probably benign 0.03
R4859:Lonp1 UTSW 17 56626587 missense probably benign 0.00
R4951:Lonp1 UTSW 17 56620335 missense possibly damaging 0.64
R5208:Lonp1 UTSW 17 56617793 missense probably damaging 1.00
R5620:Lonp1 UTSW 17 56620263 missense probably benign 0.05
R5621:Lonp1 UTSW 17 56620263 missense probably benign 0.05
R6131:Lonp1 UTSW 17 56614457 missense probably benign 0.01
R6377:Lonp1 UTSW 17 56621961 missense possibly damaging 0.90
R6692:Lonp1 UTSW 17 56619230 missense probably damaging 1.00
R7052:Lonp1 UTSW 17 56626549 missense probably benign 0.31
R7131:Lonp1 UTSW 17 56617814 missense probably damaging 1.00
R7295:Lonp1 UTSW 17 56622495 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TCTTCAAGAGAGACAGGGCC -3'
(R):5'- GAGCTATCTATCACTGAAGCCAG -3'

Sequencing Primer
(F):5'- GCCTTATAGAGCCGCTTAAGGATC -3'
(R):5'- CTATCACTGAAGCCAGAGTATGTG -3'
Posted On2016-11-08