Incidental Mutation 'R5622:Apcdd1'
ID 441658
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Name adenomatosis polyposis coli down-regulated 1
Synonyms Drapc1, EIG180
MMRRC Submission 043161-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock # R5622 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 62922327-62953195 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 62936902 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
AlphaFold Q3U128
Predicted Effect probably null
Transcript: ENSMUST00000096554
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163716
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,327,668 S320T probably benign Het
Alg8 T A 7: 97,386,799 probably benign Het
Anp32b G A 4: 46,469,930 E202K unknown Het
Apobec2 A G 17: 48,423,416 V74A possibly damaging Het
Arid3c A T 4: 41,729,959 C79S probably benign Het
Atp1a2 A T 1: 172,291,427 probably benign Het
B2m A T 2: 122,150,990 N62I probably damaging Het
Borcs5 T C 6: 134,686,123 probably null Het
Cdk11b A G 4: 155,630,217 K127E probably damaging Het
Cep170 T C 1: 176,735,867 H726R possibly damaging Het
Col5a2 A C 1: 45,427,059 S190A probably benign Het
Cryba4 T C 5: 112,251,124 D5G probably damaging Het
Cyp2a5 T G 7: 26,835,874 V87G probably damaging Het
Cyr61 A G 3: 145,649,320 L60P probably damaging Het
Dcaf8 A G 1: 172,186,398 probably benign Het
Dchs1 A G 7: 105,755,293 S2681P probably benign Het
Ddx20 A G 3: 105,679,011 S673P probably damaging Het
Deptor T A 15: 55,181,032 I198N probably damaging Het
Ebf2 T C 14: 67,390,558 I334T possibly damaging Het
F5 A G 1: 164,192,565 R870G probably benign Het
Flg2 A C 3: 93,202,564 H633P unknown Het
Gm11938 T A 11: 99,603,293 probably null Het
Gm5771 A C 6: 41,396,150 N119H probably damaging Het
Gm6370 A G 5: 146,493,898 T298A probably benign Het
Gm9825 C T 6: 7,982,605 noncoding transcript Het
H60b C A 10: 22,283,542 probably benign Het
Hsbp1 A G 8: 119,344,585 T4A possibly damaging Het
Hsd3b3 A T 3: 98,742,208 D266E possibly damaging Het
Ift172 T C 5: 31,283,082 Y287C probably damaging Het
Il20rb T A 9: 100,486,318 Q4L probably benign Het
Krt5 T C 15: 101,709,035 D421G probably damaging Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Me3 A G 7: 89,796,663 D196G probably damaging Het
Mfsd12 T A 10: 81,363,627 V451E probably null Het
Mib1 A G 18: 10,794,503 N663S possibly damaging Het
Mtus2 A T 5: 148,078,434 N679I probably benign Het
Myt1 A G 2: 181,797,122 T146A probably benign Het
Neb T A 2: 52,270,269 H2244L probably damaging Het
Olfr1444 A C 19: 12,862,299 I175L probably benign Het
Olfr510 C T 7: 108,668,082 T222I probably benign Het
Olfr630 T C 7: 103,755,169 T139A probably damaging Het
Pabpc4 A G 4: 123,291,731 probably null Het
Padi1 C A 4: 140,824,955 V393L probably damaging Het
Pax2 A T 19: 44,818,466 D300V probably damaging Het
Pcgf2 T C 11: 97,690,252 E71G probably damaging Het
Pi4kb A G 3: 94,998,861 Q573R possibly damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pkd1 A G 17: 24,574,040 E1567G possibly damaging Het
Plcb2 A T 2: 118,714,729 S630R probably damaging Het
Prrt2 A T 7: 127,019,765 V176D probably benign Het
Prss42 T C 9: 110,799,422 probably null Het
Rhoq A G 17: 86,997,031 R197G probably benign Het
Rin2 A T 2: 145,860,379 T332S probably benign Het
Rp1 A T 1: 4,347,837 N1017K possibly damaging Het
Setbp1 T A 18: 78,857,485 Y989F probably damaging Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc35f5 G A 1: 125,589,956 R497Q probably damaging Het
Slf1 T C 13: 77,049,971 K728R probably benign Het
Tiparp T G 3: 65,547,525 S364A probably benign Het
Tph1 G A 7: 46,647,545 Q409* probably null Het
Trp73 A T 4: 154,060,592 I526N possibly damaging Het
Ttc9c G A 19: 8,815,968 R103* probably null Het
Vmn2r75 T A 7: 86,148,494 I704F probably benign Het
Wdr76 A G 2: 121,517,735 R63G probably damaging Het
Zc3h3 T A 15: 75,777,079 S735C probably damaging Het
Zfp383 G A 7: 29,912,190 V32M probably damaging Het
Zfp810 T A 9: 22,279,096 Y172F probably benign Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 62933865 splice site probably benign
IGL01522:Apcdd1 APN 18 62952115 missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 62937286 missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 62949983 missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 62951854 missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 62950188 missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 62951820 splice site probably benign
R0207:Apcdd1 UTSW 18 62950079 missense probably benign 0.04
R0363:Apcdd1 UTSW 18 62937097 missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0567:Apcdd1 UTSW 18 62934036 missense possibly damaging 0.93
R0607:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 62933970 missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 62952024 missense probably benign
R1178:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1180:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 62951932 missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 62937034 missense probably benign 0.01
R5771:Apcdd1 UTSW 18 62936956 missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 62937063 missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 62951869 missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 62937366 missense probably damaging 1.00
R6515:Apcdd1 UTSW 18 62951839 missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 62951858 missense probably damaging 1.00
R6831:Apcdd1 UTSW 18 62950126 nonsense probably null
R6931:Apcdd1 UTSW 18 62933908 missense probably damaging 1.00
R7018:Apcdd1 UTSW 18 62937049 missense probably damaging 0.98
R7115:Apcdd1 UTSW 18 62936953 missense probably damaging 1.00
R7148:Apcdd1 UTSW 18 62951845 missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 62952188 nonsense probably null
R8025:Apcdd1 UTSW 18 62936908 missense probably damaging 1.00
R8114:Apcdd1 UTSW 18 62950056 missense probably damaging 1.00
R8261:Apcdd1 UTSW 18 62933903 missense possibly damaging 0.86
R8404:Apcdd1 UTSW 18 62933915 missense possibly damaging 0.66
R9015:Apcdd1 UTSW 18 62950086 missense possibly damaging 0.93
R9040:Apcdd1 UTSW 18 62937343 missense probably damaging 0.96
R9288:Apcdd1 UTSW 18 62922660 start gained probably benign
R9295:Apcdd1 UTSW 18 62922660 start gained probably benign
R9297:Apcdd1 UTSW 18 62922660 start gained probably benign
R9317:Apcdd1 UTSW 18 62922660 start gained probably benign
R9319:Apcdd1 UTSW 18 62922660 start gained probably benign
R9393:Apcdd1 UTSW 18 62922660 start gained probably benign
R9394:Apcdd1 UTSW 18 62922660 start gained probably benign
R9396:Apcdd1 UTSW 18 62922660 start gained probably benign
R9397:Apcdd1 UTSW 18 62922660 start gained probably benign
X0028:Apcdd1 UTSW 18 62937130 missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 62937183 missense probably benign 0.18
Z1177:Apcdd1 UTSW 18 62922691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTGCCTAGATTCATGGTCAGAC -3'
(R):5'- ATGACTTGGACGCCGTGAAG -3'

Sequencing Primer
(F):5'- GCCTAGATTCATGGTCAGACTCATG -3'
(R):5'- CCGTGAAGCTGGTAGTCAG -3'
Posted On 2016-11-08