Mutagenetix > Incidental Mutations

Incidental Mutation 'R5622:Apcdd1'

441658

Institutional Source

Beutler Lab

Gene Symbol

Apcdd1

Ensembl Gene

ENSMUSG00000071847

Gene Name

adenomatosis polyposis coli down-regulated 1

Synonyms

Drapc1, EIG180

MMRRC Submission

043161-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.165) question?

Stock #

R5622 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62922327-62953195 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 62936902 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125868 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]

AlphaFold

Q3U128

Predicted Effect

probably null
Transcript: ENSMUST00000096554

SMART Domains

Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000163716

SMART Domains

Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.2%
20x: 95.2%

Validation Efficiency

97% (69/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	A	T	17: 24,327,668	S320T	probably benign	Het
Alg8	T	A	7: 97,386,799		probably benign	Het
Anp32b	G	A	4: 46,469,930	E202K	unknown	Het
Apobec2	A	G	17: 48,423,416	V74A	possibly damaging	Het
Arid3c	A	T	4: 41,729,959	C79S	probably benign	Het
Atp1a2	A	T	1: 172,291,427		probably benign	Het
B2m	A	T	2: 122,150,990	N62I	probably damaging	Het
Borcs5	T	C	6: 134,686,123		probably null	Het
Cdk11b	A	G	4: 155,630,217	K127E	probably damaging	Het
Cep170	T	C	1: 176,735,867	H726R	possibly damaging	Het
Col5a2	A	C	1: 45,427,059	S190A	probably benign	Het
Cryba4	T	C	5: 112,251,124	D5G	probably damaging	Het
Cyp2a5	T	G	7: 26,835,874	V87G	probably damaging	Het
Cyr61	A	G	3: 145,649,320	L60P	probably damaging	Het
Dcaf8	A	G	1: 172,186,398		probably benign	Het
Dchs1	A	G	7: 105,755,293	S2681P	probably benign	Het
Ddx20	A	G	3: 105,679,011	S673P	probably damaging	Het
Deptor	T	A	15: 55,181,032	I198N	probably damaging	Het
Ebf2	T	C	14: 67,390,558	I334T	possibly damaging	Het
F5	A	G	1: 164,192,565	R870G	probably benign	Het
Flg2	A	C	3: 93,202,564	H633P	unknown	Het
Gm11938	T	A	11: 99,603,293		probably null	Het
Gm5771	A	C	6: 41,396,150	N119H	probably damaging	Het
Gm6370	A	G	5: 146,493,898	T298A	probably benign	Het
Gm9825	C	T	6: 7,982,605		noncoding transcript	Het
H60b	C	A	10: 22,283,542		probably benign	Het
Hsbp1	A	G	8: 119,344,585	T4A	possibly damaging	Het
Hsd3b3	A	T	3: 98,742,208	D266E	possibly damaging	Het
Ift172	T	C	5: 31,283,082	Y287C	probably damaging	Het
Il20rb	T	A	9: 100,486,318	Q4L	probably benign	Het
Krt5	T	C	15: 101,709,035	D421G	probably damaging	Het
Lonp1	G	C	17: 56,620,263	A330G	probably benign	Het
Me3	A	G	7: 89,796,663	D196G	probably damaging	Het
Mfsd12	T	A	10: 81,363,627	V451E	probably null	Het
Mib1	A	G	18: 10,794,503	N663S	possibly damaging	Het
Mtus2	A	T	5: 148,078,434	N679I	probably benign	Het
Myt1	A	G	2: 181,797,122	T146A	probably benign	Het
Neb	T	A	2: 52,270,269	H2244L	probably damaging	Het
Olfr1444	A	C	19: 12,862,299	I175L	probably benign	Het
Olfr510	C	T	7: 108,668,082	T222I	probably benign	Het
Olfr630	T	C	7: 103,755,169	T139A	probably damaging	Het
Pabpc4	A	G	4: 123,291,731		probably null	Het
Padi1	C	A	4: 140,824,955	V393L	probably damaging	Het
Pax2	A	T	19: 44,818,466	D300V	probably damaging	Het
Pcgf2	T	C	11: 97,690,252	E71G	probably damaging	Het
Pi4kb	A	G	3: 94,998,861	Q573R	possibly damaging	Het
Pitpna	T	A	11: 75,620,327	M242K	possibly damaging	Het
Pkd1	A	G	17: 24,574,040	E1567G	possibly damaging	Het
Plcb2	A	T	2: 118,714,729	S630R	probably damaging	Het
Prrt2	A	T	7: 127,019,765	V176D	probably benign	Het
Prss42	T	C	9: 110,799,422		probably null	Het
Rhoq	A	G	17: 86,997,031	R197G	probably benign	Het
Rin2	A	T	2: 145,860,379	T332S	probably benign	Het
Rp1	A	T	1: 4,347,837	N1017K	possibly damaging	Het
Setbp1	T	A	18: 78,857,485	Y989F	probably damaging	Het
Slc11a1	G	A	1: 74,380,906	G191D	probably damaging	Het
Slc35f5	G	A	1: 125,589,956	R497Q	probably damaging	Het
Slf1	T	C	13: 77,049,971	K728R	probably benign	Het
Tiparp	T	G	3: 65,547,525	S364A	probably benign	Het
Tph1	G	A	7: 46,647,545	Q409*	probably null	Het
Trp73	A	T	4: 154,060,592	I526N	possibly damaging	Het
Ttc9c	G	A	19: 8,815,968	R103*	probably null	Het
Vmn2r75	T	A	7: 86,148,494	I704F	probably benign	Het
Wdr76	A	G	2: 121,517,735	R63G	probably damaging	Het
Zc3h3	T	A	15: 75,777,079	S735C	probably damaging	Het
Zfp383	G	A	7: 29,912,190	V32M	probably damaging	Het
Zfp810	T	A	9: 22,279,096	Y172F	probably benign	Het

Other mutations in Apcdd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00805:Apcdd1	APN	18	62933865	splice site	probably benign
IGL01522:Apcdd1	APN	18	62952115	missense	possibly damaging	0.50
IGL01637:Apcdd1	APN	18	62937286	missense	probably damaging	1.00
IGL02069:Apcdd1	APN	18	62949983	missense	probably damaging	1.00
IGL02183:Apcdd1	APN	18	62951854	missense	probably damaging	0.98
IGL02268:Apcdd1	APN	18	62950188	missense	probably damaging	0.99
IGL02664:Apcdd1	APN	18	62951820	splice site	probably benign
R0207:Apcdd1	UTSW	18	62950079	missense	probably benign	0.04
R0363:Apcdd1	UTSW	18	62937097	missense	possibly damaging	0.46
R0540:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0567:Apcdd1	UTSW	18	62934036	missense	possibly damaging	0.93
R0607:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0629:Apcdd1	UTSW	18	62933970	missense	probably damaging	1.00
R1118:Apcdd1	UTSW	18	62952024	missense	probably benign
R1178:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1180:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1181:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R4363:Apcdd1	UTSW	18	62951932	missense	possibly damaging	0.95
R5534:Apcdd1	UTSW	18	62937034	missense	probably benign	0.01
R5771:Apcdd1	UTSW	18	62936956	missense	probably damaging	1.00
R5852:Apcdd1	UTSW	18	62937063	missense	probably damaging	1.00
R5934:Apcdd1	UTSW	18	62951869	missense	possibly damaging	0.72
R6109:Apcdd1	UTSW	18	62937366	missense	probably damaging	1.00
R6515:Apcdd1	UTSW	18	62951839	missense	probably damaging	1.00
R6625:Apcdd1	UTSW	18	62951858	missense	probably damaging	1.00
R6831:Apcdd1	UTSW	18	62950126	nonsense	probably null
R6931:Apcdd1	UTSW	18	62933908	missense	probably damaging	1.00
R7018:Apcdd1	UTSW	18	62937049	missense	probably damaging	0.98
R7115:Apcdd1	UTSW	18	62936953	missense	probably damaging	1.00
R7148:Apcdd1	UTSW	18	62951845	missense	probably damaging	1.00
R7326:Apcdd1	UTSW	18	62952188	nonsense	probably null
R8025:Apcdd1	UTSW	18	62936908	missense	probably damaging	1.00
R8114:Apcdd1	UTSW	18	62950056	missense	probably damaging	1.00
R8261:Apcdd1	UTSW	18	62933903	missense	possibly damaging	0.86
R8404:Apcdd1	UTSW	18	62933915	missense	possibly damaging	0.66
R9015:Apcdd1	UTSW	18	62950086	missense	possibly damaging	0.93
R9040:Apcdd1	UTSW	18	62937343	missense	probably damaging	0.96
R9288:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9295:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9297:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9317:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9319:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9393:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9394:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9396:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9397:Apcdd1	UTSW	18	62922660	start gained	probably benign
X0028:Apcdd1	UTSW	18	62937130	missense	possibly damaging	0.59
Z1088:Apcdd1	UTSW	18	62937183	missense	probably benign	0.18
Z1177:Apcdd1	UTSW	18	62922691	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATTGCCTAGATTCATGGTCAGAC -3'
(R):5'- ATGACTTGGACGCCGTGAAG -3'

Sequencing Primer
(F):5'- GCCTAGATTCATGGTCAGACTCATG -3'
(R):5'- CCGTGAAGCTGGTAGTCAG -3'

Posted On

2016-11-08