Incidental Mutation 'R5623:Cfap221'
ID441667
Institutional Source Beutler Lab
Gene Symbol Cfap221
Ensembl Gene ENSMUSG00000036962
Gene Namecilia and flagella associated protein 221
SynonymsGm101, Pcdp1
MMRRC Submission 043162-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5623 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location119923341-119997234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119954168 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 297 (A297T)
Ref Sequence ENSEMBL: ENSMUSP00000134576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037840] [ENSMUST00000174370]
Predicted Effect probably benign
Transcript: ENSMUST00000037840
AA Change: A297T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000037703
Gene: ENSMUSG00000036962
AA Change: A297T

DomainStartEndE-ValueType
low complexity region 292 301 N/A INTRINSIC
low complexity region 456 468 N/A INTRINSIC
low complexity region 614 626 N/A INTRINSIC
low complexity region 754 771 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174370
AA Change: A297T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000134576
Gene: ENSMUSG00000036962
AA Change: A297T

DomainStartEndE-ValueType
low complexity region 292 301 N/A INTRINSIC
low complexity region 456 468 N/A INTRINSIC
low complexity region 614 626 N/A INTRINSIC
low complexity region 754 771 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b1 T G 18: 64,546,094 Q772P possibly damaging Het
B3gnt2 C G 11: 22,837,018 A57P probably damaging Het
BC067074 T C 13: 113,346,634 I1590T possibly damaging Het
Birc6 T G 17: 74,528,656 D63E probably damaging Het
Ccdc13 T C 9: 121,833,733 E72G probably damaging Het
Chd1 T A 17: 15,754,932 N1081K probably damaging Het
Chrm3 C A 13: 9,877,387 V538L possibly damaging Het
Clec16a T A 16: 10,611,121 N37K probably benign Het
Cnksr3 T A 10: 7,120,548 I229F probably damaging Het
Dchs1 T C 7: 105,772,769 E148G probably damaging Het
Diaph1 A T 18: 37,896,093 probably benign Het
Dis3l A G 9: 64,307,603 F895L possibly damaging Het
Dnah1 G T 14: 31,286,023 D2142E possibly damaging Het
Dst T C 1: 34,190,133 V1944A possibly damaging Het
Eif4a2 C T 16: 23,110,219 probably benign Het
Ephb6 T A 6: 41,616,481 M487K probably benign Het
Fgf18 T G 11: 33,134,272 T61P probably damaging Het
G6pc2 A G 2: 69,226,583 E191G probably damaging Het
Gm10717 C T 9: 3,026,318 S55L probably benign Het
Gm5414 A G 15: 101,625,811 F286S probably damaging Het
Gpcpd1 G T 2: 132,534,717 A553E probably damaging Het
Gpr153 A G 4: 152,281,941 D321G possibly damaging Het
Hecw2 T A 1: 53,832,623 Q1388L probably null Het
Ighv14-3 A C 12: 114,060,090 S36A probably damaging Het
Inpp5j C A 11: 3,494,766 G969V probably damaging Het
Kat5 G A 19: 5,607,562 R307W probably damaging Het
Klk1b21 A G 7: 44,105,565 S95G probably damaging Het
Mdm1 G A 10: 118,150,789 V171I possibly damaging Het
Nfu1 TCGC T 6: 87,016,206 probably benign Het
Olfr175-ps1 C T 16: 58,824,343 R122H probably benign Het
Olfr776 G A 10: 129,261,032 V24M probably benign Het
Phkb T A 8: 85,843,048 probably benign Het
Pkd1l3 A T 8: 109,623,719 T399S possibly damaging Het
Prr14l A T 5: 32,844,508 probably benign Het
Psg21 A C 7: 18,655,014 L51R probably damaging Het
Ptprg T A 14: 12,153,857 I526N probably damaging Het
Rab1a T C 11: 20,201,626 probably benign Het
Rims2 A T 15: 39,478,615 Q620L probably damaging Het
Rnf215 T G 11: 4,135,453 S58A probably benign Het
Scaper A C 9: 55,864,507 V375G probably benign Het
Sgk3 A T 1: 9,802,295 probably benign Het
Skiv2l T C 17: 34,847,432 K192E probably benign Het
Slc34a3 T A 2: 25,233,300 probably null Het
Sspn T A 6: 145,961,226 C52S probably damaging Het
Strip1 T C 3: 107,626,826 E164G possibly damaging Het
Sult5a1 A C 8: 123,157,442 S47A probably damaging Het
Svep1 T C 4: 58,091,964 D1557G possibly damaging Het
Tdrd6 T C 17: 43,629,333 I275V probably damaging Het
Thada C T 17: 84,191,983 V1929I probably benign Het
Tmem132b G A 5: 125,623,352 R318Q probably damaging Het
Tmem176b T G 6: 48,834,070 I259L probably benign Het
Tmppe C A 9: 114,405,896 P421Q possibly damaging Het
Tmprss11e G A 5: 86,709,456 Q333* probably null Het
Tpcn2 T A 7: 145,267,334 R328W possibly damaging Het
Trem1 C T 17: 48,237,055 T36I probably damaging Het
Trpm2 C A 10: 77,932,139 R842L probably damaging Het
Zfp319 A G 8: 95,325,571 probably benign Het
Other mutations in Cfap221
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Cfap221 APN 1 119932845 missense possibly damaging 0.89
IGL00954:Cfap221 APN 1 119934209 missense probably damaging 1.00
IGL01340:Cfap221 APN 1 119953620 missense possibly damaging 0.76
IGL01413:Cfap221 APN 1 119985071 missense possibly damaging 0.84
IGL01418:Cfap221 APN 1 119985071 missense possibly damaging 0.84
IGL01730:Cfap221 APN 1 119934111 missense probably benign 0.01
IGL01931:Cfap221 APN 1 119932895 missense probably damaging 1.00
IGL02936:Cfap221 APN 1 119984752 missense probably damaging 1.00
IGL03309:Cfap221 APN 1 119934601 missense probably damaging 1.00
Ningxia UTSW 1 119953659 missense probably benign 0.08
R0365:Cfap221 UTSW 1 119985023 missense probably benign 0.00
R0396:Cfap221 UTSW 1 119954200 missense probably benign 0.00
R1505:Cfap221 UTSW 1 119953628 missense probably benign 0.04
R1740:Cfap221 UTSW 1 119945828 missense probably benign
R1873:Cfap221 UTSW 1 119953659 missense probably benign 0.08
R1875:Cfap221 UTSW 1 119953659 missense probably benign 0.08
R2205:Cfap221 UTSW 1 119936104 missense possibly damaging 0.76
R3885:Cfap221 UTSW 1 119954146 critical splice donor site probably null
R4290:Cfap221 UTSW 1 119930920 missense probably benign 0.00
R4856:Cfap221 UTSW 1 119934204 missense probably damaging 0.99
R4856:Cfap221 UTSW 1 119984758 missense probably damaging 0.99
R4886:Cfap221 UTSW 1 119934204 missense probably damaging 0.99
R4886:Cfap221 UTSW 1 119984758 missense probably damaging 0.99
R4890:Cfap221 UTSW 1 119955746 missense probably benign 0.01
R5644:Cfap221 UTSW 1 119932802 missense probably damaging 1.00
R5758:Cfap221 UTSW 1 119934558 missense probably benign 0.00
R5959:Cfap221 UTSW 1 119932781 missense probably damaging 1.00
R6145:Cfap221 UTSW 1 119984816 missense possibly damaging 0.92
R6186:Cfap221 UTSW 1 119934610 missense probably damaging 1.00
R6431:Cfap221 UTSW 1 119932853 missense probably damaging 1.00
R6700:Cfap221 UTSW 1 119955691 missense possibly damaging 0.71
R7109:Cfap221 UTSW 1 119925571 missense possibly damaging 0.92
R7166:Cfap221 UTSW 1 119948113 missense probably benign 0.06
R7273:Cfap221 UTSW 1 119954218 missense possibly damaging 0.83
R7343:Cfap221 UTSW 1 119995098 missense possibly damaging 0.92
R7486:Cfap221 UTSW 1 119923592 missense possibly damaging 0.71
R7698:Cfap221 UTSW 1 119961929 nonsense probably null
X0017:Cfap221 UTSW 1 119961989 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGTCCTGATAATCAATTTCCTGGGAAC -3'
(R):5'- ACAAAGTCCTTGAGCTATGTGGG -3'

Sequencing Primer
(F):5'- gtgtgtgtgtgtgtgtgt -3'
(R):5'- ATGGCAGCTCACAACTGTCTG -3'
Posted On2016-11-08