Incidental Mutation 'R5623:Strip1'
ID441671
Institutional Source Beutler Lab
Gene Symbol Strip1
Ensembl Gene ENSMUSG00000014601
Gene Namestriatin interacting protein 1
Synonyms
MMRRC Submission 043162-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R5623 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107612532-107631694 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107626826 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 164 (E164G)
Ref Sequence ENSEMBL: ENSMUSP00000068587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064759] [ENSMUST00000106703]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064759
AA Change: E164G

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000068587
Gene: ENSMUSG00000014601
AA Change: E164G

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
N1221 65 363 7.87e-138 SMART
low complexity region 376 394 N/A INTRINSIC
DUF3402 460 817 6.87e-202 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198424
Meta Mutation Damage Score 0.6496 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the striatin-interacting phosphatase and kinase complex, which is involved in localization of the Golgi body. The encoded protein participates in cytosketelal organization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality, shortened anterior-posterior axis, cinching of tissue at the embryonic/extraembryonic boundary and abnormal mesoderm development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b1 T G 18: 64,546,094 Q772P possibly damaging Het
B3gnt2 C G 11: 22,837,018 A57P probably damaging Het
BC067074 T C 13: 113,346,634 I1590T possibly damaging Het
Birc6 T G 17: 74,528,656 D63E probably damaging Het
Ccdc13 T C 9: 121,833,733 E72G probably damaging Het
Cfap221 C T 1: 119,954,168 A297T probably benign Het
Chd1 T A 17: 15,754,932 N1081K probably damaging Het
Chrm3 C A 13: 9,877,387 V538L possibly damaging Het
Clec16a T A 16: 10,611,121 N37K probably benign Het
Cnksr3 T A 10: 7,120,548 I229F probably damaging Het
Dchs1 T C 7: 105,772,769 E148G probably damaging Het
Diaph1 A T 18: 37,896,093 probably benign Het
Dis3l A G 9: 64,307,603 F895L possibly damaging Het
Dnah1 G T 14: 31,286,023 D2142E possibly damaging Het
Dst T C 1: 34,190,133 V1944A possibly damaging Het
Eif4a2 C T 16: 23,110,219 probably benign Het
Ephb6 T A 6: 41,616,481 M487K probably benign Het
Fgf18 T G 11: 33,134,272 T61P probably damaging Het
G6pc2 A G 2: 69,226,583 E191G probably damaging Het
Gm10717 C T 9: 3,026,318 S55L probably benign Het
Gm5414 A G 15: 101,625,811 F286S probably damaging Het
Gpcpd1 G T 2: 132,534,717 A553E probably damaging Het
Gpr153 A G 4: 152,281,941 D321G possibly damaging Het
Hecw2 T A 1: 53,832,623 Q1388L probably null Het
Ighv14-3 A C 12: 114,060,090 S36A probably damaging Het
Inpp5j C A 11: 3,494,766 G969V probably damaging Het
Kat5 G A 19: 5,607,562 R307W probably damaging Het
Klk1b21 A G 7: 44,105,565 S95G probably damaging Het
Mdm1 G A 10: 118,150,789 V171I possibly damaging Het
Nfu1 TCGC T 6: 87,016,206 probably benign Het
Olfr175-ps1 C T 16: 58,824,343 R122H probably benign Het
Olfr776 G A 10: 129,261,032 V24M probably benign Het
Phkb T A 8: 85,843,048 probably benign Het
Pkd1l3 A T 8: 109,623,719 T399S possibly damaging Het
Prr14l A T 5: 32,844,508 probably benign Het
Psg21 A C 7: 18,655,014 L51R probably damaging Het
Ptprg T A 14: 12,153,857 I526N probably damaging Het
Rab1a T C 11: 20,201,626 probably benign Het
Rims2 A T 15: 39,478,615 Q620L probably damaging Het
Rnf215 T G 11: 4,135,453 S58A probably benign Het
Scaper A C 9: 55,864,507 V375G probably benign Het
Sgk3 A T 1: 9,802,295 probably benign Het
Skiv2l T C 17: 34,847,432 K192E probably benign Het
Slc34a3 T A 2: 25,233,300 probably null Het
Sspn T A 6: 145,961,226 C52S probably damaging Het
Sult5a1 A C 8: 123,157,442 S47A probably damaging Het
Svep1 T C 4: 58,091,964 D1557G possibly damaging Het
Tdrd6 T C 17: 43,629,333 I275V probably damaging Het
Thada C T 17: 84,191,983 V1929I probably benign Het
Tmem132b G A 5: 125,623,352 R318Q probably damaging Het
Tmem176b T G 6: 48,834,070 I259L probably benign Het
Tmppe C A 9: 114,405,896 P421Q possibly damaging Het
Tmprss11e G A 5: 86,709,456 Q333* probably null Het
Tpcn2 T A 7: 145,267,334 R328W possibly damaging Het
Trem1 C T 17: 48,237,055 T36I probably damaging Het
Trpm2 C A 10: 77,932,139 R842L probably damaging Het
Zfp319 A G 8: 95,325,571 probably benign Het
Other mutations in Strip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Strip1 APN 3 107621445 missense probably damaging 0.99
IGL01150:Strip1 APN 3 107626731 splice site probably null
IGL01484:Strip1 APN 3 107613259 missense probably damaging 0.99
IGL01862:Strip1 APN 3 107621882 missense probably damaging 0.99
IGL02425:Strip1 APN 3 107614646 missense probably benign 0.08
IGL02537:Strip1 APN 3 107616894 missense possibly damaging 0.94
IGL02948:Strip1 APN 3 107613266 missense probably benign 0.33
IGL03179:Strip1 APN 3 107620255 missense probably damaging 0.99
PIT4472001:Strip1 UTSW 3 107628170 missense probably benign 0.19
R0197:Strip1 UTSW 3 107614613 missense probably damaging 0.99
R0526:Strip1 UTSW 3 107620039 critical splice donor site probably null
R0543:Strip1 UTSW 3 107626775 missense possibly damaging 0.93
R0883:Strip1 UTSW 3 107614613 missense probably damaging 0.99
R1070:Strip1 UTSW 3 107627408 missense possibly damaging 0.81
R1384:Strip1 UTSW 3 107626839 missense probably benign 0.00
R1467:Strip1 UTSW 3 107627408 missense possibly damaging 0.81
R1467:Strip1 UTSW 3 107627408 missense possibly damaging 0.81
R1772:Strip1 UTSW 3 107626731 splice site probably null
R2358:Strip1 UTSW 3 107615819 missense probably benign 0.01
R2484:Strip1 UTSW 3 107628221 missense possibly damaging 0.81
R2931:Strip1 UTSW 3 107625659 intron probably null
R3427:Strip1 UTSW 3 107616822 missense possibly damaging 0.68
R4584:Strip1 UTSW 3 107624503 missense probably benign 0.39
R4780:Strip1 UTSW 3 107626998 missense probably benign 0.01
R4853:Strip1 UTSW 3 107616916 missense possibly damaging 0.93
R5801:Strip1 UTSW 3 107621441 missense possibly damaging 0.50
R6345:Strip1 UTSW 3 107628200 missense probably damaging 1.00
R6860:Strip1 UTSW 3 107618936 missense possibly damaging 0.50
R6869:Strip1 UTSW 3 107613445 missense probably damaging 1.00
R7022:Strip1 UTSW 3 107626795 missense probably benign 0.09
R7192:Strip1 UTSW 3 107615335 missense possibly damaging 0.94
R7387:Strip1 UTSW 3 107625730 missense probably damaging 0.99
R7631:Strip1 UTSW 3 107616931 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGGCCTATTTACCTGTCTCAAATG -3'
(R):5'- AGTGGACTGAGCTGGATACC -3'

Sequencing Primer
(F):5'- CTCAAATGCTAGTTCTAGAAGCTCGG -3'
(R):5'- CCATGAGGCTTCTGGATGGC -3'
Posted On2016-11-08