Incidental Mutation 'R5623:Gpr153'
ID441673
Institutional Source Beutler Lab
Gene Symbol Gpr153
Ensembl Gene ENSMUSG00000042804
Gene NameG protein-coupled receptor 153
Synonyms1110065N12Rik, PGR1
MMRRC Submission 043162-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5623 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location152274232-152285337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152281941 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 321 (D321G)
Ref Sequence ENSEMBL: ENSMUSP00000101276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055754] [ENSMUST00000094438] [ENSMUST00000105650] [ENSMUST00000105651] [ENSMUST00000218045]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055754
AA Change: D321G

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052742
Gene: ENSMUSG00000042804
AA Change: D321G

DomainStartEndE-ValueType
Pfam:7tm_1 24 298 1.2e-14 PFAM
low complexity region 501 518 N/A INTRINSIC
low complexity region 605 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094438
SMART Domains Protein: ENSMUSP00000092006
Gene: ENSMUSG00000028946

DomainStartEndE-ValueType
HLH 1 55 3.83e-11 SMART
low complexity region 129 148 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105650
AA Change: D321G

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101275
Gene: ENSMUSG00000042804
AA Change: D321G

DomainStartEndE-ValueType
Pfam:7tm_1 24 297 5.4e-18 PFAM
low complexity region 478 495 N/A INTRINSIC
low complexity region 582 594 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105651
AA Change: D321G

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101276
Gene: ENSMUSG00000042804
AA Change: D321G

DomainStartEndE-ValueType
Pfam:7tm_1 24 297 5.3e-17 PFAM
low complexity region 501 518 N/A INTRINSIC
low complexity region 605 617 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144035
Predicted Effect probably benign
Transcript: ENSMUST00000218045
Meta Mutation Damage Score 0.1468 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that belongs to the Class A rhodopsin superfamily of G protein coupled receptors. The encoded protein is expressed primarily in the central nervous system. A knockdown of the orthologous gene in rat is associated with a significant reduction in food intake and impaired decision making ability. Mutations in this gene are associated with schizophrenia, autism, and other neuropsychiatric disorders. The expression of this gene is activated by the glioma-associated oncogene homolog 1 transcription factor which, in turn, is activated by sonic hedgehog in normal and tumorigenic cells. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b1 T G 18: 64,546,094 Q772P possibly damaging Het
B3gnt2 C G 11: 22,837,018 A57P probably damaging Het
BC067074 T C 13: 113,346,634 I1590T possibly damaging Het
Birc6 T G 17: 74,528,656 D63E probably damaging Het
Ccdc13 T C 9: 121,833,733 E72G probably damaging Het
Cfap221 C T 1: 119,954,168 A297T probably benign Het
Chd1 T A 17: 15,754,932 N1081K probably damaging Het
Chrm3 C A 13: 9,877,387 V538L possibly damaging Het
Clec16a T A 16: 10,611,121 N37K probably benign Het
Cnksr3 T A 10: 7,120,548 I229F probably damaging Het
Dchs1 T C 7: 105,772,769 E148G probably damaging Het
Diaph1 A T 18: 37,896,093 probably benign Het
Dis3l A G 9: 64,307,603 F895L possibly damaging Het
Dnah1 G T 14: 31,286,023 D2142E possibly damaging Het
Dst T C 1: 34,190,133 V1944A possibly damaging Het
Eif4a2 C T 16: 23,110,219 probably benign Het
Ephb6 T A 6: 41,616,481 M487K probably benign Het
Fgf18 T G 11: 33,134,272 T61P probably damaging Het
G6pc2 A G 2: 69,226,583 E191G probably damaging Het
Gm10717 C T 9: 3,026,318 S55L probably benign Het
Gm5414 A G 15: 101,625,811 F286S probably damaging Het
Gpcpd1 G T 2: 132,534,717 A553E probably damaging Het
Hecw2 T A 1: 53,832,623 Q1388L probably null Het
Ighv14-3 A C 12: 114,060,090 S36A probably damaging Het
Inpp5j C A 11: 3,494,766 G969V probably damaging Het
Kat5 G A 19: 5,607,562 R307W probably damaging Het
Klk1b21 A G 7: 44,105,565 S95G probably damaging Het
Mdm1 G A 10: 118,150,789 V171I possibly damaging Het
Nfu1 TCGC T 6: 87,016,206 probably benign Het
Olfr175-ps1 C T 16: 58,824,343 R122H probably benign Het
Olfr776 G A 10: 129,261,032 V24M probably benign Het
Phkb T A 8: 85,843,048 probably benign Het
Pkd1l3 A T 8: 109,623,719 T399S possibly damaging Het
Prr14l A T 5: 32,844,508 probably benign Het
Psg21 A C 7: 18,655,014 L51R probably damaging Het
Ptprg T A 14: 12,153,857 I526N probably damaging Het
Rab1a T C 11: 20,201,626 probably benign Het
Rims2 A T 15: 39,478,615 Q620L probably damaging Het
Rnf215 T G 11: 4,135,453 S58A probably benign Het
Scaper A C 9: 55,864,507 V375G probably benign Het
Sgk3 A T 1: 9,802,295 probably benign Het
Skiv2l T C 17: 34,847,432 K192E probably benign Het
Slc34a3 T A 2: 25,233,300 probably null Het
Sspn T A 6: 145,961,226 C52S probably damaging Het
Strip1 T C 3: 107,626,826 E164G possibly damaging Het
Sult5a1 A C 8: 123,157,442 S47A probably damaging Het
Svep1 T C 4: 58,091,964 D1557G possibly damaging Het
Tdrd6 T C 17: 43,629,333 I275V probably damaging Het
Thada C T 17: 84,191,983 V1929I probably benign Het
Tmem132b G A 5: 125,623,352 R318Q probably damaging Het
Tmem176b T G 6: 48,834,070 I259L probably benign Het
Tmppe C A 9: 114,405,896 P421Q possibly damaging Het
Tmprss11e G A 5: 86,709,456 Q333* probably null Het
Tpcn2 T A 7: 145,267,334 R328W possibly damaging Het
Trem1 C T 17: 48,237,055 T36I probably damaging Het
Trpm2 C A 10: 77,932,139 R842L probably damaging Het
Zfp319 A G 8: 95,325,571 probably benign Het
Other mutations in Gpr153
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Gpr153 APN 4 152281966 unclassified probably benign
IGL01368:Gpr153 APN 4 152282994 missense probably benign 0.40
IGL01568:Gpr153 APN 4 152282368 splice site probably null
IGL01672:Gpr153 APN 4 152279913 nonsense probably null
R0735:Gpr153 UTSW 4 152279373 nonsense probably null
R0925:Gpr153 UTSW 4 152281874 missense probably benign
R1302:Gpr153 UTSW 4 152279943 missense probably damaging 1.00
R1829:Gpr153 UTSW 4 152282392 missense possibly damaging 0.70
R2041:Gpr153 UTSW 4 152283353 missense probably benign
R4698:Gpr153 UTSW 4 152281783 missense probably damaging 1.00
R5069:Gpr153 UTSW 4 152279883 missense probably damaging 0.99
R5800:Gpr153 UTSW 4 152280077 nonsense probably null
R5940:Gpr153 UTSW 4 152283375 missense probably benign 0.12
R6773:Gpr153 UTSW 4 152279300 missense probably damaging 1.00
R6944:Gpr153 UTSW 4 152279363 missense probably damaging 1.00
R7486:Gpr153 UTSW 4 152282401 missense probably benign 0.01
R8170:Gpr153 UTSW 4 152280177 missense probably damaging 1.00
R8699:Gpr153 UTSW 4 152279101 start gained probably benign
R8701:Gpr153 UTSW 4 152279101 start gained probably benign
R8732:Gpr153 UTSW 4 152279101 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGAGCTTCAGTAGTCTGCGG -3'
(R):5'- GGAACTGCATGGGACTAAATACCC -3'

Sequencing Primer
(F):5'- TCTGCGGGCAGATGCTTCAG -3'
(R):5'- GTGCCGACTTGTGTTGCCAC -3'
Posted On2016-11-08