Incidental Mutation 'R5623:Ephb6'
ID441676
Institutional Source Beutler Lab
Gene Symbol Ephb6
Ensembl Gene ENSMUSG00000029869
Gene NameEph receptor B6
SynonymsCekl, Mep
MMRRC Submission 043162-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.691) question?
Stock #R5623 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41605482-41620509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41616481 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 487 (M487K)
Ref Sequence ENSEMBL: ENSMUSP00000110380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031902] [ENSMUST00000114732] [ENSMUST00000201471]
Predicted Effect probably benign
Transcript: ENSMUST00000031902
SMART Domains Protein: ENSMUSP00000031902
Gene: ENSMUSG00000029868

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114732
AA Change: M487K

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869
AA Change: M487K

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
EPH_lbd 34 227 2.18e-100 SMART
low complexity region 242 255 N/A INTRINSIC
Pfam:GCC2_GCC3 299 341 1.9e-9 PFAM
FN3 365 462 3.59e-3 SMART
FN3 481 562 3.73e-10 SMART
Pfam:EphA2_TM 589 660 3.4e-16 PFAM
Pfam:Pkinase 663 908 1.4e-29 PFAM
Pfam:Pkinase_Tyr 663 908 1.1e-67 PFAM
SAM 938 1005 1e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167082
Predicted Effect probably benign
Transcript: ENSMUST00000167497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170624
Predicted Effect probably benign
Transcript: ENSMUST00000201471
SMART Domains Protein: ENSMUSP00000143854
Gene: ENSMUSG00000029868

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transmembrane proteins that function as receptors for ephrin-B family proteins. Unlike other members of this family, the encoded protein does not contain a functional kinase domain. Activity of this protein can influence cell adhesion and migration. Expression of this gene is downregulated during tumor progression, suggesting that the protein may suppress tumor invasion and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: T cell responses such as lymphokine secretion, proliferation, and the development of delayed-type skin hypersensitivity and experimental autoimmune encephalitis were compromised in homozygous null mutants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b1 T G 18: 64,546,094 Q772P possibly damaging Het
B3gnt2 C G 11: 22,837,018 A57P probably damaging Het
BC067074 T C 13: 113,346,634 I1590T possibly damaging Het
Birc6 T G 17: 74,528,656 D63E probably damaging Het
Ccdc13 T C 9: 121,833,733 E72G probably damaging Het
Cfap221 C T 1: 119,954,168 A297T probably benign Het
Chd1 T A 17: 15,754,932 N1081K probably damaging Het
Chrm3 C A 13: 9,877,387 V538L possibly damaging Het
Clec16a T A 16: 10,611,121 N37K probably benign Het
Cnksr3 T A 10: 7,120,548 I229F probably damaging Het
Dchs1 T C 7: 105,772,769 E148G probably damaging Het
Diaph1 A T 18: 37,896,093 probably benign Het
Dis3l A G 9: 64,307,603 F895L possibly damaging Het
Dnah1 G T 14: 31,286,023 D2142E possibly damaging Het
Dst T C 1: 34,190,133 V1944A possibly damaging Het
Eif4a2 C T 16: 23,110,219 probably benign Het
Fgf18 T G 11: 33,134,272 T61P probably damaging Het
G6pc2 A G 2: 69,226,583 E191G probably damaging Het
Gm10717 C T 9: 3,026,318 S55L probably benign Het
Gm5414 A G 15: 101,625,811 F286S probably damaging Het
Gpcpd1 G T 2: 132,534,717 A553E probably damaging Het
Gpr153 A G 4: 152,281,941 D321G possibly damaging Het
Hecw2 T A 1: 53,832,623 Q1388L probably null Het
Ighv14-3 A C 12: 114,060,090 S36A probably damaging Het
Inpp5j C A 11: 3,494,766 G969V probably damaging Het
Kat5 G A 19: 5,607,562 R307W probably damaging Het
Klk1b21 A G 7: 44,105,565 S95G probably damaging Het
Mdm1 G A 10: 118,150,789 V171I possibly damaging Het
Nfu1 TCGC T 6: 87,016,206 probably benign Het
Olfr175-ps1 C T 16: 58,824,343 R122H probably benign Het
Olfr776 G A 10: 129,261,032 V24M probably benign Het
Phkb T A 8: 85,843,048 probably benign Het
Pkd1l3 A T 8: 109,623,719 T399S possibly damaging Het
Prr14l A T 5: 32,844,508 probably benign Het
Psg21 A C 7: 18,655,014 L51R probably damaging Het
Ptprg T A 14: 12,153,857 I526N probably damaging Het
Rab1a T C 11: 20,201,626 probably benign Het
Rims2 A T 15: 39,478,615 Q620L probably damaging Het
Rnf215 T G 11: 4,135,453 S58A probably benign Het
Scaper A C 9: 55,864,507 V375G probably benign Het
Sgk3 A T 1: 9,802,295 probably benign Het
Skiv2l T C 17: 34,847,432 K192E probably benign Het
Slc34a3 T A 2: 25,233,300 probably null Het
Sspn T A 6: 145,961,226 C52S probably damaging Het
Strip1 T C 3: 107,626,826 E164G possibly damaging Het
Sult5a1 A C 8: 123,157,442 S47A probably damaging Het
Svep1 T C 4: 58,091,964 D1557G possibly damaging Het
Tdrd6 T C 17: 43,629,333 I275V probably damaging Het
Thada C T 17: 84,191,983 V1929I probably benign Het
Tmem132b G A 5: 125,623,352 R318Q probably damaging Het
Tmem176b T G 6: 48,834,070 I259L probably benign Het
Tmppe C A 9: 114,405,896 P421Q possibly damaging Het
Tmprss11e G A 5: 86,709,456 Q333* probably null Het
Tpcn2 T A 7: 145,267,334 R328W possibly damaging Het
Trem1 C T 17: 48,237,055 T36I probably damaging Het
Trpm2 C A 10: 77,932,139 R842L probably damaging Het
Zfp319 A G 8: 95,325,571 probably benign Het
Other mutations in Ephb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Ephb6 APN 6 41615911 unclassified probably benign
IGL01691:Ephb6 APN 6 41614515 missense probably benign 0.26
IGL02052:Ephb6 APN 6 41613322 missense probably benign
IGL02079:Ephb6 APN 6 41616014 missense possibly damaging 0.57
IGL03089:Ephb6 APN 6 41614174 missense probably damaging 1.00
P4748:Ephb6 UTSW 6 41617285 missense probably damaging 0.96
R0022:Ephb6 UTSW 6 41614569 missense probably damaging 0.98
R0022:Ephb6 UTSW 6 41614569 missense probably damaging 0.98
R0106:Ephb6 UTSW 6 41619594 unclassified probably benign
R0106:Ephb6 UTSW 6 41619594 unclassified probably benign
R0973:Ephb6 UTSW 6 41614104 missense probably damaging 0.98
R0973:Ephb6 UTSW 6 41614104 missense probably damaging 0.98
R0974:Ephb6 UTSW 6 41614104 missense probably damaging 0.98
R1465:Ephb6 UTSW 6 41616106 missense probably damaging 1.00
R1465:Ephb6 UTSW 6 41616106 missense probably damaging 1.00
R1610:Ephb6 UTSW 6 41614373 nonsense probably null
R1658:Ephb6 UTSW 6 41614245 missense probably damaging 1.00
R1687:Ephb6 UTSW 6 41617366 missense probably benign 0.08
R1733:Ephb6 UTSW 6 41619720 missense probably benign 0.10
R2191:Ephb6 UTSW 6 41616085 missense possibly damaging 0.82
R2439:Ephb6 UTSW 6 41618735 missense probably benign 0.31
R2915:Ephb6 UTSW 6 41614238 missense probably damaging 1.00
R3020:Ephb6 UTSW 6 41614521 missense probably damaging 1.00
R3499:Ephb6 UTSW 6 41616159 nonsense probably null
R4606:Ephb6 UTSW 6 41616574 missense probably benign 0.15
R4663:Ephb6 UTSW 6 41617865 missense probably damaging 1.00
R4668:Ephb6 UTSW 6 41614602 missense possibly damaging 0.91
R4762:Ephb6 UTSW 6 41618160 missense probably damaging 0.99
R4767:Ephb6 UTSW 6 41614185 missense possibly damaging 0.81
R4780:Ephb6 UTSW 6 41616139 missense probably damaging 1.00
R4846:Ephb6 UTSW 6 41616809 missense probably benign
R4851:Ephb6 UTSW 6 41618145 missense probably benign 0.00
R5016:Ephb6 UTSW 6 41618107 missense probably benign 0.01
R5122:Ephb6 UTSW 6 41613404 missense probably benign 0.00
R5313:Ephb6 UTSW 6 41616793 missense possibly damaging 0.68
R5615:Ephb6 UTSW 6 41619291 missense probably benign
R5686:Ephb6 UTSW 6 41619704 missense possibly damaging 0.57
R5840:Ephb6 UTSW 6 41615573 missense possibly damaging 0.94
R6147:Ephb6 UTSW 6 41616781 missense probably damaging 1.00
R6645:Ephb6 UTSW 6 41617272 missense probably benign 0.01
R6730:Ephb6 UTSW 6 41617374 nonsense probably null
R7412:Ephb6 UTSW 6 41620239 missense probably damaging 1.00
R7442:Ephb6 UTSW 6 41618047 splice site probably null
R7759:Ephb6 UTSW 6 41614605 missense probably benign 0.00
R7857:Ephb6 UTSW 6 41613397 missense probably benign
R8425:Ephb6 UTSW 6 41618646 missense probably damaging 0.98
X0027:Ephb6 UTSW 6 41620080 makesense probably null
Predicted Primers PCR Primer
(F):5'- AAGGACAGCTTGCTTCAGC -3'
(R):5'- TCCGTGATATCCCTAGTGCC -3'

Sequencing Primer
(F):5'- AGCTTGCTTCAGCTCCTCGG -3'
(R):5'- AGTGCCCTCCTCCAAGC -3'
Posted On2016-11-08