Mutagenetix > Incidental Mutations

Incidental Mutation 'R5623:Ephb6'

441676

Institutional Source

Beutler Lab

Gene Symbol

Ephb6

Ensembl Gene

ENSMUSG00000029869

Gene Name

Eph receptor B6

Synonyms

Cekl, Mep

MMRRC Submission

043162-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.691) question?

Stock #

R5623 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41605482-41620509 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 41616481 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 487 (M487K)

Ref Sequence

ENSEMBL: ENSMUSP00000110380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031902] [ENSMUST00000114732] [ENSMUST00000201471]

Predicted Effect

probably benign
Transcript: ENSMUST00000031902

SMART Domains

Protein: ENSMUSP00000031902
Gene: ENSMUSG00000029868

Domain	Start	End	E-Value	Type
ANK	44	74	2.39e2	SMART
ANK	78	107	6.17e-1	SMART
ANK	116	145	3.06e-5	SMART
ANK	162	191	1.85e-4	SMART
Blast:ANK	195	223	3e-10	BLAST
ANK	238	267	2.47e2	SMART
Pfam:Ion_trans	327	589	9.8e-18	PFAM
low complexity region	680	695	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114732
AA Change: M487K

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869
AA Change: M487K

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
EPH_lbd	34	227	2.18e-100	SMART
low complexity region	242	255	N/A	INTRINSIC
Pfam:GCC2_GCC3	299	341	1.9e-9	PFAM
FN3	365	462	3.59e-3	SMART
FN3	481	562	3.73e-10	SMART
Pfam:EphA2_TM	589	660	3.4e-16	PFAM
Pfam:Pkinase	663	908	1.4e-29	PFAM
Pfam:Pkinase_Tyr	663	908	1.1e-67	PFAM
SAM	938	1005	1e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167082

Predicted Effect

probably benign
Transcript: ENSMUST00000167497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170624

Predicted Effect

probably benign
Transcript: ENSMUST00000201471

SMART Domains

Protein: ENSMUSP00000143854
Gene: ENSMUSG00000029868

Domain	Start	End	E-Value	Type
ANK	44	74	2.39e2	SMART
ANK	78	107	6.17e-1	SMART
ANK	116	145	3.06e-5	SMART
ANK	162	191	1.85e-4	SMART
Blast:ANK	195	223	3e-10	BLAST
ANK	238	267	2.47e2	SMART
Pfam:Ion_trans	327	589	9.8e-18	PFAM
low complexity region	680	695	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.2%
20x: 95.0%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transmembrane proteins that function as receptors for ephrin-B family proteins. Unlike other members of this family, the encoded protein does not contain a functional kinase domain. Activity of this protein can influence cell adhesion and migration. Expression of this gene is downregulated during tumor progression, suggesting that the protein may suppress tumor invasion and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: T cell responses such as lymphokine secretion, proliferation, and the development of delayed-type skin hypersensitivity and experimental autoimmune encephalitis were compromised in homozygous null mutants. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp8b1	T	G	18: 64,546,094	Q772P	possibly damaging	Het
B3gnt2	C	G	11: 22,837,018	A57P	probably damaging	Het
BC067074	T	C	13: 113,346,634	I1590T	possibly damaging	Het
Birc6	T	G	17: 74,528,656	D63E	probably damaging	Het
Ccdc13	T	C	9: 121,833,733	E72G	probably damaging	Het
Cfap221	C	T	1: 119,954,168	A297T	probably benign	Het
Chd1	T	A	17: 15,754,932	N1081K	probably damaging	Het
Chrm3	C	A	13: 9,877,387	V538L	possibly damaging	Het
Clec16a	T	A	16: 10,611,121	N37K	probably benign	Het
Cnksr3	T	A	10: 7,120,548	I229F	probably damaging	Het
Dchs1	T	C	7: 105,772,769	E148G	probably damaging	Het
Diaph1	A	T	18: 37,896,093		probably benign	Het
Dis3l	A	G	9: 64,307,603	F895L	possibly damaging	Het
Dnah1	G	T	14: 31,286,023	D2142E	possibly damaging	Het
Dst	T	C	1: 34,190,133	V1944A	possibly damaging	Het
Eif4a2	C	T	16: 23,110,219		probably benign	Het
Fgf18	T	G	11: 33,134,272	T61P	probably damaging	Het
G6pc2	A	G	2: 69,226,583	E191G	probably damaging	Het
Gm10717	C	T	9: 3,026,318	S55L	probably benign	Het
Gm5414	A	G	15: 101,625,811	F286S	probably damaging	Het
Gpcpd1	G	T	2: 132,534,717	A553E	probably damaging	Het
Gpr153	A	G	4: 152,281,941	D321G	possibly damaging	Het
Hecw2	T	A	1: 53,832,623	Q1388L	probably null	Het
Ighv14-3	A	C	12: 114,060,090	S36A	probably damaging	Het
Inpp5j	C	A	11: 3,494,766	G969V	probably damaging	Het
Kat5	G	A	19: 5,607,562	R307W	probably damaging	Het
Klk1b21	A	G	7: 44,105,565	S95G	probably damaging	Het
Mdm1	G	A	10: 118,150,789	V171I	possibly damaging	Het
Nfu1	TCGC	T	6: 87,016,206		probably benign	Het
Olfr175-ps1	C	T	16: 58,824,343	R122H	probably benign	Het
Olfr776	G	A	10: 129,261,032	V24M	probably benign	Het
Phkb	T	A	8: 85,843,048		probably benign	Het
Pkd1l3	A	T	8: 109,623,719	T399S	possibly damaging	Het
Prr14l	A	T	5: 32,844,508		probably benign	Het
Psg21	A	C	7: 18,655,014	L51R	probably damaging	Het
Ptprg	T	A	14: 12,153,857	I526N	probably damaging	Het
Rab1a	T	C	11: 20,201,626		probably benign	Het
Rims2	A	T	15: 39,478,615	Q620L	probably damaging	Het
Rnf215	T	G	11: 4,135,453	S58A	probably benign	Het
Scaper	A	C	9: 55,864,507	V375G	probably benign	Het
Sgk3	A	T	1: 9,802,295		probably benign	Het
Skiv2l	T	C	17: 34,847,432	K192E	probably benign	Het
Slc34a3	T	A	2: 25,233,300		probably null	Het
Sspn	T	A	6: 145,961,226	C52S	probably damaging	Het
Strip1	T	C	3: 107,626,826	E164G	possibly damaging	Het
Sult5a1	A	C	8: 123,157,442	S47A	probably damaging	Het
Svep1	T	C	4: 58,091,964	D1557G	possibly damaging	Het
Tdrd6	T	C	17: 43,629,333	I275V	probably damaging	Het
Thada	C	T	17: 84,191,983	V1929I	probably benign	Het
Tmem132b	G	A	5: 125,623,352	R318Q	probably damaging	Het
Tmem176b	T	G	6: 48,834,070	I259L	probably benign	Het
Tmppe	C	A	9: 114,405,896	P421Q	possibly damaging	Het
Tmprss11e	G	A	5: 86,709,456	Q333*	probably null	Het
Tpcn2	T	A	7: 145,267,334	R328W	possibly damaging	Het
Trem1	C	T	17: 48,237,055	T36I	probably damaging	Het
Trpm2	C	A	10: 77,932,139	R842L	probably damaging	Het
Zfp319	A	G	8: 95,325,571		probably benign	Het

Other mutations in Ephb6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Ephb6	APN	6	41615911	unclassified	probably benign
IGL01691:Ephb6	APN	6	41614515	missense	probably benign	0.26
IGL02052:Ephb6	APN	6	41613322	missense	probably benign
IGL02079:Ephb6	APN	6	41616014	missense	possibly damaging	0.57
IGL03089:Ephb6	APN	6	41614174	missense	probably damaging	1.00
P4748:Ephb6	UTSW	6	41617285	missense	probably damaging	0.96
R0022:Ephb6	UTSW	6	41614569	missense	probably damaging	0.98
R0022:Ephb6	UTSW	6	41614569	missense	probably damaging	0.98
R0106:Ephb6	UTSW	6	41619594	unclassified	probably benign
R0106:Ephb6	UTSW	6	41619594	unclassified	probably benign
R0973:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R0973:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R0974:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R1465:Ephb6	UTSW	6	41616106	missense	probably damaging	1.00
R1465:Ephb6	UTSW	6	41616106	missense	probably damaging	1.00
R1610:Ephb6	UTSW	6	41614373	nonsense	probably null
R1658:Ephb6	UTSW	6	41614245	missense	probably damaging	1.00
R1687:Ephb6	UTSW	6	41617366	missense	probably benign	0.08
R1733:Ephb6	UTSW	6	41619720	missense	probably benign	0.10
R2191:Ephb6	UTSW	6	41616085	missense	possibly damaging	0.82
R2439:Ephb6	UTSW	6	41618735	missense	probably benign	0.31
R2915:Ephb6	UTSW	6	41614238	missense	probably damaging	1.00
R3020:Ephb6	UTSW	6	41614521	missense	probably damaging	1.00
R3499:Ephb6	UTSW	6	41616159	nonsense	probably null
R4606:Ephb6	UTSW	6	41616574	missense	probably benign	0.15
R4663:Ephb6	UTSW	6	41617865	missense	probably damaging	1.00
R4668:Ephb6	UTSW	6	41614602	missense	possibly damaging	0.91
R4762:Ephb6	UTSW	6	41618160	missense	probably damaging	0.99
R4767:Ephb6	UTSW	6	41614185	missense	possibly damaging	0.81
R4780:Ephb6	UTSW	6	41616139	missense	probably damaging	1.00
R4846:Ephb6	UTSW	6	41616809	missense	probably benign
R4851:Ephb6	UTSW	6	41618145	missense	probably benign	0.00
R5016:Ephb6	UTSW	6	41618107	missense	probably benign	0.01
R5122:Ephb6	UTSW	6	41613404	missense	probably benign	0.00
R5313:Ephb6	UTSW	6	41616793	missense	possibly damaging	0.68
R5615:Ephb6	UTSW	6	41619291	missense	probably benign
R5686:Ephb6	UTSW	6	41619704	missense	possibly damaging	0.57
R5840:Ephb6	UTSW	6	41615573	missense	possibly damaging	0.94
R6147:Ephb6	UTSW	6	41616781	missense	probably damaging	1.00
R6645:Ephb6	UTSW	6	41617272	missense	probably benign	0.01
R6730:Ephb6	UTSW	6	41617374	nonsense	probably null
R7412:Ephb6	UTSW	6	41620239	missense	probably damaging	1.00
R7442:Ephb6	UTSW	6	41618047	splice site	probably null
R7759:Ephb6	UTSW	6	41614605	missense	probably benign	0.00
R7857:Ephb6	UTSW	6	41613397	missense	probably benign
R8425:Ephb6	UTSW	6	41618646	missense	probably damaging	0.98
X0027:Ephb6	UTSW	6	41620080	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- AAGGACAGCTTGCTTCAGC -3'
(R):5'- TCCGTGATATCCCTAGTGCC -3'

Sequencing Primer
(F):5'- AGCTTGCTTCAGCTCCTCGG -3'
(R):5'- AGTGCCCTCCTCCAAGC -3'

Posted On

2016-11-08