Incidental Mutation 'R5623:Psg21'
ID 441680
Institutional Source Beutler Lab
Gene Symbol Psg21
Ensembl Gene ENSMUSG00000070796
Gene Name pregnancy-specific glycoprotein 21
Synonyms 1600026N13Rik, 1600019C01Rik, 1600025N01Rik, cea8
MMRRC Submission 043162-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock # R5623 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 18646736-18656725 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 18655014 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 51 (L51R)
Ref Sequence ENSEMBL: ENSMUSP00000138173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094793] [ENSMUST00000182128]
AlphaFold Q9DAV5
Predicted Effect probably damaging
Transcript: ENSMUST00000094793
AA Change: L51R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092387
Gene: ENSMUSG00000070796
AA Change: L51R

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
IGc2 393 457 1.47e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182128
AA Change: L51R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138173
Gene: ENSMUSG00000070796
AA Change: L51R

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182933
Meta Mutation Damage Score 0.4352 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b1 T G 18: 64,546,094 Q772P possibly damaging Het
B3gnt2 C G 11: 22,837,018 A57P probably damaging Het
BC067074 T C 13: 113,346,634 I1590T possibly damaging Het
Birc6 T G 17: 74,528,656 D63E probably damaging Het
Ccdc13 T C 9: 121,833,733 E72G probably damaging Het
Cfap221 C T 1: 119,954,168 A297T probably benign Het
Chd1 T A 17: 15,754,932 N1081K probably damaging Het
Chrm3 C A 13: 9,877,387 V538L possibly damaging Het
Clec16a T A 16: 10,611,121 N37K probably benign Het
Cnksr3 T A 10: 7,120,548 I229F probably damaging Het
Dchs1 T C 7: 105,772,769 E148G probably damaging Het
Diaph1 A T 18: 37,896,093 probably benign Het
Dis3l A G 9: 64,307,603 F895L possibly damaging Het
Dnah1 G T 14: 31,286,023 D2142E possibly damaging Het
Dst T C 1: 34,190,133 V1944A possibly damaging Het
Eif4a2 C T 16: 23,110,219 probably benign Het
Ephb6 T A 6: 41,616,481 M487K probably benign Het
Fgf18 T G 11: 33,134,272 T61P probably damaging Het
G6pc2 A G 2: 69,226,583 E191G probably damaging Het
Gm10717 C T 9: 3,026,318 S55L probably benign Het
Gm5414 A G 15: 101,625,811 F286S probably damaging Het
Gpcpd1 G T 2: 132,534,717 A553E probably damaging Het
Gpr153 A G 4: 152,281,941 D321G possibly damaging Het
Hecw2 T A 1: 53,832,623 Q1388L probably null Het
Ighv14-3 A C 12: 114,060,090 S36A probably damaging Het
Inpp5j C A 11: 3,494,766 G969V probably damaging Het
Kat5 G A 19: 5,607,562 R307W probably damaging Het
Klk1b21 A G 7: 44,105,565 S95G probably damaging Het
Mdm1 G A 10: 118,150,789 V171I possibly damaging Het
Nfu1 TCGC T 6: 87,016,206 probably benign Het
Olfr175-ps1 C T 16: 58,824,343 R122H probably benign Het
Olfr776 G A 10: 129,261,032 V24M probably benign Het
Phkb T A 8: 85,843,048 probably benign Het
Pkd1l3 A T 8: 109,623,719 T399S possibly damaging Het
Prr14l A T 5: 32,844,508 probably benign Het
Ptprg T A 14: 12,153,857 I526N probably damaging Het
Rab1a T C 11: 20,201,626 probably benign Het
Rims2 A T 15: 39,478,615 Q620L probably damaging Het
Rnf215 T G 11: 4,135,453 S58A probably benign Het
Scaper A C 9: 55,864,507 V375G probably benign Het
Sgk3 A T 1: 9,802,295 probably benign Het
Skiv2l T C 17: 34,847,432 K192E probably benign Het
Slc34a3 T A 2: 25,233,300 probably null Het
Sspn T A 6: 145,961,226 C52S probably damaging Het
Strip1 T C 3: 107,626,826 E164G possibly damaging Het
Sult5a1 A C 8: 123,157,442 S47A probably damaging Het
Svep1 T C 4: 58,091,964 D1557G possibly damaging Het
Tdrd6 T C 17: 43,629,333 I275V probably damaging Het
Thada C T 17: 84,191,983 V1929I probably benign Het
Tmem132b G A 5: 125,623,352 R318Q probably damaging Het
Tmem176b T G 6: 48,834,070 I259L probably benign Het
Tmppe C A 9: 114,405,896 P421Q possibly damaging Het
Tmprss11e G A 5: 86,709,456 Q333* probably null Het
Tpcn2 T A 7: 145,267,334 R328W possibly damaging Het
Trem1 C T 17: 48,237,055 T36I probably damaging Het
Trpm2 C A 10: 77,932,139 R842L probably damaging Het
Zfp319 A G 8: 95,325,571 probably benign Het
Other mutations in Psg21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Psg21 APN 7 18654825 missense probably damaging 1.00
IGL02390:Psg21 APN 7 18652631 missense probably benign 0.11
IGL02548:Psg21 APN 7 18655036 missense possibly damaging 0.89
IGL03001:Psg21 APN 7 18652485 missense probably benign 0.03
IGL03135:Psg21 APN 7 18654918 missense probably benign 0.00
R0131:Psg21 UTSW 7 18654868 missense probably benign 0.39
R0551:Psg21 UTSW 7 18652640 critical splice acceptor site probably null
R1512:Psg21 UTSW 7 18656500 missense probably benign 0.00
R1874:Psg21 UTSW 7 18650816 missense probably benign 0.15
R1993:Psg21 UTSW 7 18654770 missense probably benign 0.04
R2327:Psg21 UTSW 7 18652453 missense possibly damaging 0.61
R3414:Psg21 UTSW 7 18652380 missense probably damaging 1.00
R4422:Psg21 UTSW 7 18647332 missense probably damaging 1.00
R5138:Psg21 UTSW 7 18656528 start codon destroyed probably null 0.94
R5686:Psg21 UTSW 7 18652258 intron probably benign
R6166:Psg21 UTSW 7 18656739 unclassified probably benign
R6177:Psg21 UTSW 7 18652354 missense possibly damaging 0.64
R6190:Psg21 UTSW 7 18655001 missense possibly damaging 0.61
R6210:Psg21 UTSW 7 18652345 missense probably damaging 1.00
R6482:Psg21 UTSW 7 18654739 splice site probably null
R6729:Psg21 UTSW 7 18652591 missense probably damaging 1.00
R6866:Psg21 UTSW 7 18652284 missense probably damaging 1.00
R6992:Psg21 UTSW 7 18654743 critical splice donor site probably null
R7075:Psg21 UTSW 7 18654861 missense probably damaging 1.00
R7081:Psg21 UTSW 7 18654849 nonsense probably null
R7098:Psg21 UTSW 7 18652545 missense probably damaging 1.00
R7582:Psg21 UTSW 7 18647203 makesense probably null
R7588:Psg21 UTSW 7 18647209 missense probably benign 0.00
R7607:Psg21 UTSW 7 18654783 missense probably benign 0.02
R7830:Psg21 UTSW 7 18647298 missense probably damaging 1.00
R7964:Psg21 UTSW 7 18647211 missense probably benign 0.01
R8758:Psg21 UTSW 7 18650753 missense probably damaging 1.00
R8972:Psg21 UTSW 7 18647368 missense probably benign 0.03
R8988:Psg21 UTSW 7 18652464 missense probably benign 0.00
R9119:Psg21 UTSW 7 18647484 missense probably benign 0.14
R9446:Psg21 UTSW 7 18654940 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGGGTGACATTTTGGATCCATAG -3'
(R):5'- AGAAACGACACCCTCTGAGG -3'

Sequencing Primer
(F):5'- AGGGACCCGTTGCTGTACAATATC -3'
(R):5'- TCATCTCTATTATGGGCACACC -3'
Posted On 2016-11-08