Incidental Mutation 'R5623:Klk1b21'
ID441681
Institutional Source Beutler Lab
Gene Symbol Klk1b21
Ensembl Gene ENSMUSG00000066516
Gene Namekallikrein 1-related peptidase b21
SynonymsKlk21, mGk-21
MMRRC Submission 043162-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5623 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44102328-44106583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44105565 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 95 (S95G)
Ref Sequence ENSEMBL: ENSMUSP00000082582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085455]
Predicted Effect probably damaging
Transcript: ENSMUST00000085455
AA Change: S95G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082582
Gene: ENSMUSG00000066516
AA Change: S95G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 9.09e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205984
Meta Mutation Damage Score 0.1920 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b1 T G 18: 64,546,094 Q772P possibly damaging Het
B3gnt2 C G 11: 22,837,018 A57P probably damaging Het
BC067074 T C 13: 113,346,634 I1590T possibly damaging Het
Birc6 T G 17: 74,528,656 D63E probably damaging Het
Ccdc13 T C 9: 121,833,733 E72G probably damaging Het
Cfap221 C T 1: 119,954,168 A297T probably benign Het
Chd1 T A 17: 15,754,932 N1081K probably damaging Het
Chrm3 C A 13: 9,877,387 V538L possibly damaging Het
Clec16a T A 16: 10,611,121 N37K probably benign Het
Cnksr3 T A 10: 7,120,548 I229F probably damaging Het
Dchs1 T C 7: 105,772,769 E148G probably damaging Het
Diaph1 A T 18: 37,896,093 probably benign Het
Dis3l A G 9: 64,307,603 F895L possibly damaging Het
Dnah1 G T 14: 31,286,023 D2142E possibly damaging Het
Dst T C 1: 34,190,133 V1944A possibly damaging Het
Eif4a2 C T 16: 23,110,219 probably benign Het
Ephb6 T A 6: 41,616,481 M487K probably benign Het
Fgf18 T G 11: 33,134,272 T61P probably damaging Het
G6pc2 A G 2: 69,226,583 E191G probably damaging Het
Gm10717 C T 9: 3,026,318 S55L probably benign Het
Gm5414 A G 15: 101,625,811 F286S probably damaging Het
Gpcpd1 G T 2: 132,534,717 A553E probably damaging Het
Gpr153 A G 4: 152,281,941 D321G possibly damaging Het
Hecw2 T A 1: 53,832,623 Q1388L probably null Het
Ighv14-3 A C 12: 114,060,090 S36A probably damaging Het
Inpp5j C A 11: 3,494,766 G969V probably damaging Het
Kat5 G A 19: 5,607,562 R307W probably damaging Het
Mdm1 G A 10: 118,150,789 V171I possibly damaging Het
Nfu1 TCGC T 6: 87,016,206 probably benign Het
Olfr175-ps1 C T 16: 58,824,343 R122H probably benign Het
Olfr776 G A 10: 129,261,032 V24M probably benign Het
Phkb T A 8: 85,843,048 probably benign Het
Pkd1l3 A T 8: 109,623,719 T399S possibly damaging Het
Prr14l A T 5: 32,844,508 probably benign Het
Psg21 A C 7: 18,655,014 L51R probably damaging Het
Ptprg T A 14: 12,153,857 I526N probably damaging Het
Rab1a T C 11: 20,201,626 probably benign Het
Rims2 A T 15: 39,478,615 Q620L probably damaging Het
Rnf215 T G 11: 4,135,453 S58A probably benign Het
Scaper A C 9: 55,864,507 V375G probably benign Het
Sgk3 A T 1: 9,802,295 probably benign Het
Skiv2l T C 17: 34,847,432 K192E probably benign Het
Slc34a3 T A 2: 25,233,300 probably null Het
Sspn T A 6: 145,961,226 C52S probably damaging Het
Strip1 T C 3: 107,626,826 E164G possibly damaging Het
Sult5a1 A C 8: 123,157,442 S47A probably damaging Het
Svep1 T C 4: 58,091,964 D1557G possibly damaging Het
Tdrd6 T C 17: 43,629,333 I275V probably damaging Het
Thada C T 17: 84,191,983 V1929I probably benign Het
Tmem132b G A 5: 125,623,352 R318Q probably damaging Het
Tmem176b T G 6: 48,834,070 I259L probably benign Het
Tmppe C A 9: 114,405,896 P421Q possibly damaging Het
Tmprss11e G A 5: 86,709,456 Q333* probably null Het
Tpcn2 T A 7: 145,267,334 R328W possibly damaging Het
Trem1 C T 17: 48,237,055 T36I probably damaging Het
Trpm2 C A 10: 77,932,139 R842L probably damaging Het
Zfp319 A G 8: 95,325,571 probably benign Het
Other mutations in Klk1b21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Klk1b21 APN 7 44105923 missense possibly damaging 0.81
IGL01710:Klk1b21 APN 7 44106495 missense probably benign 0.13
IGL02015:Klk1b21 APN 7 44104358 missense probably benign 0.41
R0138:Klk1b21 UTSW 7 44105895 missense probably damaging 1.00
R0384:Klk1b21 UTSW 7 44105493 missense probably benign 0.03
R1456:Klk1b21 UTSW 7 44105499 missense probably benign 0.01
R2021:Klk1b21 UTSW 7 44105994 nonsense probably null
R2119:Klk1b21 UTSW 7 44105769 missense probably benign
R2265:Klk1b21 UTSW 7 44104439 missense possibly damaging 0.51
R2267:Klk1b21 UTSW 7 44104439 missense possibly damaging 0.51
R2269:Klk1b21 UTSW 7 44104439 missense possibly damaging 0.51
R5499:Klk1b21 UTSW 7 44105676 missense probably benign 0.07
R8151:Klk1b21 UTSW 7 44104363 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGCTCTCAGGTCTGTCCG -3'
(R):5'- CACATTTCGTGGGTGTAATGC -3'

Sequencing Primer
(F):5'- TCAGGTCTGTCCGGACTC -3'
(R):5'- CTGAGGCTAGGCATGTGCTC -3'
Posted On2016-11-08