Incidental Mutation 'R5623:Scaper'
ID 441688
Institutional Source Beutler Lab
Gene Symbol Scaper
Ensembl Gene ENSMUSG00000034007
Gene Name S phase cyclin A-associated protein in the ER
Synonyms Zfp291, D530014O03Rik
MMRRC Submission 043162-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.629) question?
Stock # R5623 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 55457163-55845403 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 55771791 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 375 (V375G)
Ref Sequence ENSEMBL: ENSMUSP00000149050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037408] [ENSMUST00000214747] [ENSMUST00000216595] [ENSMUST00000217647]
AlphaFold F8VQ70
Predicted Effect probably benign
Transcript: ENSMUST00000037408
AA Change: V375G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043411
Gene: ENSMUSG00000034007
AA Change: V375G

DomainStartEndE-ValueType
Pfam:SCAPER_N 88 185 3.4e-47 PFAM
low complexity region 323 338 N/A INTRINSIC
coiled coil region 415 466 N/A INTRINSIC
coiled coil region 535 597 N/A INTRINSIC
SCOP:d1eq1a_ 605 769 3e-6 SMART
ZnF_C2H2 791 815 1.16e1 SMART
low complexity region 866 883 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214747
AA Change: V375G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000216595
Predicted Effect probably benign
Transcript: ENSMUST00000217647
AA Change: V375G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b1 T G 18: 64,679,165 (GRCm39) Q772P possibly damaging Het
B3gnt2 C G 11: 22,787,018 (GRCm39) A57P probably damaging Het
Birc6 T G 17: 74,835,651 (GRCm39) D63E probably damaging Het
Ccdc13 T C 9: 121,662,799 (GRCm39) E72G probably damaging Het
Cfap221 C T 1: 119,881,898 (GRCm39) A297T probably benign Het
Chd1 T A 17: 15,975,194 (GRCm39) N1081K probably damaging Het
Chrm3 C A 13: 9,927,423 (GRCm39) V538L possibly damaging Het
Clec16a T A 16: 10,428,985 (GRCm39) N37K probably benign Het
Cnksr3 T A 10: 7,070,548 (GRCm39) I229F probably damaging Het
Cspg4b T C 13: 113,483,168 (GRCm39) I1590T possibly damaging Het
Dchs1 T C 7: 105,421,976 (GRCm39) E148G probably damaging Het
Diaph1 A T 18: 38,029,146 (GRCm39) probably benign Het
Dis3l A G 9: 64,214,885 (GRCm39) F895L possibly damaging Het
Dnah1 G T 14: 31,007,980 (GRCm39) D2142E possibly damaging Het
Dst T C 1: 34,229,214 (GRCm39) V1944A possibly damaging Het
Eif4a2 C T 16: 22,928,969 (GRCm39) probably benign Het
Ephb6 T A 6: 41,593,415 (GRCm39) M487K probably benign Het
Fgf18 T G 11: 33,084,272 (GRCm39) T61P probably damaging Het
G6pc2 A G 2: 69,056,927 (GRCm39) E191G probably damaging Het
Gm10717 C T 9: 3,026,318 (GRCm39) S55L probably benign Het
Gm5414 A G 15: 101,534,246 (GRCm39) F286S probably damaging Het
Gpcpd1 G T 2: 132,376,637 (GRCm39) A553E probably damaging Het
Gpr153 A G 4: 152,366,398 (GRCm39) D321G possibly damaging Het
Hecw2 T A 1: 53,871,782 (GRCm39) Q1388L probably null Het
Ighv14-3 A C 12: 114,023,710 (GRCm39) S36A probably damaging Het
Inpp5j C A 11: 3,444,766 (GRCm39) G969V probably damaging Het
Kat5 G A 19: 5,657,590 (GRCm39) R307W probably damaging Het
Klk1b21 A G 7: 43,754,989 (GRCm39) S95G probably damaging Het
Mdm1 G A 10: 117,986,694 (GRCm39) V171I possibly damaging Het
Nfu1 TCGC T 6: 86,993,188 (GRCm39) probably benign Het
Or5k8 C T 16: 58,644,706 (GRCm39) R122H probably benign Het
Or6c206 G A 10: 129,096,901 (GRCm39) V24M probably benign Het
Phkb T A 8: 86,569,677 (GRCm39) probably benign Het
Pkd1l3 A T 8: 110,350,351 (GRCm39) T399S possibly damaging Het
Prr14l A T 5: 33,001,852 (GRCm39) probably benign Het
Psg21 A C 7: 18,388,939 (GRCm39) L51R probably damaging Het
Ptprg T A 14: 12,153,857 (GRCm38) I526N probably damaging Het
Rab1a T C 11: 20,151,626 (GRCm39) probably benign Het
Rims2 A T 15: 39,342,011 (GRCm39) Q620L probably damaging Het
Rnf215 T G 11: 4,085,453 (GRCm39) S58A probably benign Het
Sgk3 A T 1: 9,872,520 (GRCm39) probably benign Het
Skic2 T C 17: 35,066,408 (GRCm39) K192E probably benign Het
Slc34a3 T A 2: 25,123,312 (GRCm39) probably null Het
Sspn T A 6: 145,906,952 (GRCm39) C52S probably damaging Het
Strip1 T C 3: 107,534,142 (GRCm39) E164G possibly damaging Het
Sult5a1 A C 8: 123,884,181 (GRCm39) S47A probably damaging Het
Svep1 T C 4: 58,091,964 (GRCm39) D1557G possibly damaging Het
Tdrd6 T C 17: 43,940,224 (GRCm39) I275V probably damaging Het
Thada C T 17: 84,499,411 (GRCm39) V1929I probably benign Het
Tmem132b G A 5: 125,700,416 (GRCm39) R318Q probably damaging Het
Tmem176b T G 6: 48,811,004 (GRCm39) I259L probably benign Het
Tmppe C A 9: 114,234,964 (GRCm39) P421Q possibly damaging Het
Tmprss11e G A 5: 86,857,315 (GRCm39) Q333* probably null Het
Tpcn2 T A 7: 144,821,071 (GRCm39) R328W possibly damaging Het
Trem1 C T 17: 48,544,083 (GRCm39) T36I probably damaging Het
Trpm2 C A 10: 77,767,973 (GRCm39) R842L probably damaging Het
Zfp319 A G 8: 96,052,199 (GRCm39) probably benign Het
Other mutations in Scaper
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Scaper APN 9 55,767,143 (GRCm39) missense probably damaging 0.99
IGL00912:Scaper APN 9 55,593,239 (GRCm39) missense probably damaging 1.00
IGL01469:Scaper APN 9 55,767,051 (GRCm39) missense probably damaging 1.00
IGL01626:Scaper APN 9 55,819,335 (GRCm39) missense possibly damaging 0.61
IGL01779:Scaper APN 9 55,799,524 (GRCm39) missense probably benign 0.20
IGL02011:Scaper APN 9 55,487,606 (GRCm39) missense probably damaging 1.00
IGL02997:Scaper APN 9 55,722,783 (GRCm39) missense probably damaging 1.00
IGL03107:Scaper APN 9 55,765,686 (GRCm39) splice site probably benign
IGL03167:Scaper APN 9 55,767,108 (GRCm39) missense probably damaging 1.00
IGL03293:Scaper APN 9 55,782,107 (GRCm39) missense probably benign
IGL03340:Scaper APN 9 55,510,116 (GRCm39) missense possibly damaging 0.88
IGL03368:Scaper APN 9 55,563,311 (GRCm39) missense possibly damaging 0.53
R0111:Scaper UTSW 9 55,510,074 (GRCm39) missense probably benign 0.01
R0510:Scaper UTSW 9 55,665,346 (GRCm39) splice site probably benign
R0531:Scaper UTSW 9 55,517,158 (GRCm39) missense possibly damaging 0.91
R0558:Scaper UTSW 9 55,593,207 (GRCm39) missense probably benign 0.08
R0605:Scaper UTSW 9 55,722,802 (GRCm39) splice site probably benign
R0646:Scaper UTSW 9 55,665,340 (GRCm39) missense probably damaging 1.00
R0837:Scaper UTSW 9 55,766,326 (GRCm39) nonsense probably null
R1440:Scaper UTSW 9 55,510,202 (GRCm39) nonsense probably null
R1548:Scaper UTSW 9 55,723,954 (GRCm39) missense probably damaging 1.00
R1777:Scaper UTSW 9 55,771,830 (GRCm39) missense probably benign 0.33
R1822:Scaper UTSW 9 55,767,184 (GRCm39) missense probably damaging 0.99
R1834:Scaper UTSW 9 55,724,018 (GRCm39) missense possibly damaging 0.90
R1870:Scaper UTSW 9 55,593,222 (GRCm39) missense probably damaging 1.00
R2102:Scaper UTSW 9 55,819,334 (GRCm39) missense probably benign 0.43
R2168:Scaper UTSW 9 55,650,923 (GRCm39) missense probably damaging 1.00
R2174:Scaper UTSW 9 55,766,321 (GRCm39) missense probably null 0.01
R3690:Scaper UTSW 9 55,791,205 (GRCm39) missense probably benign 0.00
R4392:Scaper UTSW 9 55,765,399 (GRCm39) missense probably damaging 0.99
R4418:Scaper UTSW 9 55,745,464 (GRCm39) missense probably damaging 1.00
R4606:Scaper UTSW 9 55,563,187 (GRCm39) critical splice donor site probably null
R4643:Scaper UTSW 9 55,745,463 (GRCm39) missense probably damaging 0.99
R4665:Scaper UTSW 9 55,819,339 (GRCm39) missense probably damaging 1.00
R4739:Scaper UTSW 9 55,650,932 (GRCm39) missense probably damaging 1.00
R4921:Scaper UTSW 9 55,799,519 (GRCm39) missense probably benign 0.02
R4934:Scaper UTSW 9 55,716,459 (GRCm39) missense probably damaging 1.00
R4956:Scaper UTSW 9 55,745,426 (GRCm39) missense probably damaging 1.00
R5055:Scaper UTSW 9 55,767,003 (GRCm39) splice site probably null
R5107:Scaper UTSW 9 55,487,616 (GRCm39) missense probably damaging 1.00
R5155:Scaper UTSW 9 55,463,370 (GRCm39) missense probably null 1.00
R5265:Scaper UTSW 9 55,771,830 (GRCm39) missense probably benign
R5408:Scaper UTSW 9 55,493,508 (GRCm39) missense probably damaging 0.99
R5665:Scaper UTSW 9 55,714,916 (GRCm39) missense probably damaging 1.00
R5748:Scaper UTSW 9 55,766,360 (GRCm39) critical splice acceptor site probably null
R5771:Scaper UTSW 9 55,724,075 (GRCm39) missense probably damaging 1.00
R6534:Scaper UTSW 9 55,791,260 (GRCm39) missense probably benign 0.00
R6557:Scaper UTSW 9 55,458,134 (GRCm39) missense probably benign 0.02
R6651:Scaper UTSW 9 55,765,788 (GRCm39) missense probably benign 0.05
R6796:Scaper UTSW 9 55,771,711 (GRCm39) missense probably benign 0.00
R6962:Scaper UTSW 9 55,767,055 (GRCm39) missense probably benign 0.01
R7145:Scaper UTSW 9 55,819,395 (GRCm39) missense unknown
R7199:Scaper UTSW 9 55,745,460 (GRCm39) nonsense probably null
R7356:Scaper UTSW 9 55,799,495 (GRCm39) missense unknown
R7426:Scaper UTSW 9 55,669,561 (GRCm39) nonsense probably null
R7503:Scaper UTSW 9 55,715,038 (GRCm39) missense probably damaging 0.98
R7844:Scaper UTSW 9 55,722,732 (GRCm39) missense probably benign 0.04
R7966:Scaper UTSW 9 55,669,611 (GRCm39) missense probably damaging 0.98
R7992:Scaper UTSW 9 55,765,438 (GRCm39) missense probably benign 0.02
R8081:Scaper UTSW 9 55,823,330 (GRCm39) missense unknown
R8189:Scaper UTSW 9 55,819,404 (GRCm39) missense probably damaging 1.00
R8294:Scaper UTSW 9 55,517,280 (GRCm39) missense possibly damaging 0.62
R8351:Scaper UTSW 9 55,724,088 (GRCm39) missense possibly damaging 0.92
R8451:Scaper UTSW 9 55,724,088 (GRCm39) missense possibly damaging 0.92
R8473:Scaper UTSW 9 55,458,131 (GRCm39) missense probably damaging 1.00
R8476:Scaper UTSW 9 55,669,575 (GRCm39) missense probably damaging 1.00
R8504:Scaper UTSW 9 55,771,722 (GRCm39) missense probably benign
R9058:Scaper UTSW 9 55,722,762 (GRCm39) missense probably damaging 1.00
R9071:Scaper UTSW 9 55,771,803 (GRCm39) missense probably benign
R9099:Scaper UTSW 9 55,669,616 (GRCm39) missense probably damaging 0.98
R9104:Scaper UTSW 9 55,819,400 (GRCm39) missense unknown
R9516:Scaper UTSW 9 55,593,275 (GRCm39) missense probably benign 0.05
R9685:Scaper UTSW 9 55,771,835 (GRCm39) missense probably benign 0.10
X0012:Scaper UTSW 9 55,563,214 (GRCm39) missense probably damaging 0.98
X0052:Scaper UTSW 9 55,723,948 (GRCm39) missense probably damaging 1.00
Z1176:Scaper UTSW 9 55,463,532 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTTCTGTAAGGCATGAGG -3'
(R):5'- TGCTCCTTCACTTGATAGGTTAAG -3'

Sequencing Primer
(F):5'- CTGTAAGGCATGAGGTTATAATTCTG -3'
(R):5'- AGGTTAAGTAGAACTAGCTCTTACAG -3'
Posted On 2016-11-08