Mutagenetix > Incidental Mutation

Incidental Mutation 'R5623:Trpm2'

441692

Institutional Source

Beutler Lab

Gene Symbol

Trpm2

Ensembl Gene

ENSMUSG00000009292

Gene Name

transient receptor potential cation channel, subfamily M, member 2

Synonyms

LTRPC2, 9830168K16Rik, TRPC7, Trrp7

MMRRC Submission

043162-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R5623 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77907722-77970563 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 77932139 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 842 (R842L)

Ref Sequence

ENSEMBL: ENSMUSP00000101040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105401]

AlphaFold

Q91YD4

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000105400

Predicted Effect

probably damaging
Transcript: ENSMUST00000105401
AA Change: R842L

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: R842L

Domain	Start	End	E-Value	Type
low complexity region	654	672	N/A	INTRINSIC
transmembrane domain	750	772	N/A	INTRINSIC
Pfam:Ion_trans	794	1057	3.7e-21	PFAM
low complexity region	1078	1090	N/A	INTRINSIC
low complexity region	1106	1115	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC
PDB:1QVJ\|A	1236	1506	3e-37	PDB
SCOP:d1k2ea_	1369	1502	9e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126206

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140471

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153842

Meta Mutation Damage Score

0.6797

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.2%
20x: 95.0%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp8b1	T	G	18: 64,546,094	Q772P	possibly damaging	Het
B3gnt2	C	G	11: 22,837,018	A57P	probably damaging	Het
BC067074	T	C	13: 113,346,634	I1590T	possibly damaging	Het
Birc6	T	G	17: 74,528,656	D63E	probably damaging	Het
Ccdc13	T	C	9: 121,833,733	E72G	probably damaging	Het
Cfap221	C	T	1: 119,954,168	A297T	probably benign	Het
Chd1	T	A	17: 15,754,932	N1081K	probably damaging	Het
Chrm3	C	A	13: 9,877,387	V538L	possibly damaging	Het
Clec16a	T	A	16: 10,611,121	N37K	probably benign	Het
Cnksr3	T	A	10: 7,120,548	I229F	probably damaging	Het
Dchs1	T	C	7: 105,772,769	E148G	probably damaging	Het
Diaph1	A	T	18: 37,896,093		probably benign	Het
Dis3l	A	G	9: 64,307,603	F895L	possibly damaging	Het
Dnah1	G	T	14: 31,286,023	D2142E	possibly damaging	Het
Dst	T	C	1: 34,190,133	V1944A	possibly damaging	Het
Eif4a2	C	T	16: 23,110,219		probably benign	Het
Ephb6	T	A	6: 41,616,481	M487K	probably benign	Het
Fgf18	T	G	11: 33,134,272	T61P	probably damaging	Het
G6pc2	A	G	2: 69,226,583	E191G	probably damaging	Het
Gm10717	C	T	9: 3,026,318	S55L	probably benign	Het
Gm5414	A	G	15: 101,625,811	F286S	probably damaging	Het
Gpcpd1	G	T	2: 132,534,717	A553E	probably damaging	Het
Gpr153	A	G	4: 152,281,941	D321G	possibly damaging	Het
Hecw2	T	A	1: 53,832,623	Q1388L	probably null	Het
Ighv14-3	A	C	12: 114,060,090	S36A	probably damaging	Het
Inpp5j	C	A	11: 3,494,766	G969V	probably damaging	Het
Kat5	G	A	19: 5,607,562	R307W	probably damaging	Het
Klk1b21	A	G	7: 44,105,565	S95G	probably damaging	Het
Mdm1	G	A	10: 118,150,789	V171I	possibly damaging	Het
Nfu1	TCGC	T	6: 87,016,206		probably benign	Het
Olfr175-ps1	C	T	16: 58,824,343	R122H	probably benign	Het
Olfr776	G	A	10: 129,261,032	V24M	probably benign	Het
Phkb	T	A	8: 85,843,048		probably benign	Het
Pkd1l3	A	T	8: 109,623,719	T399S	possibly damaging	Het
Prr14l	A	T	5: 32,844,508		probably benign	Het
Psg21	A	C	7: 18,655,014	L51R	probably damaging	Het
Ptprg	T	A	14: 12,153,857	I526N	probably damaging	Het
Rab1a	T	C	11: 20,201,626		probably benign	Het
Rims2	A	T	15: 39,478,615	Q620L	probably damaging	Het
Rnf215	T	G	11: 4,135,453	S58A	probably benign	Het
Scaper	A	C	9: 55,864,507	V375G	probably benign	Het
Sgk3	A	T	1: 9,802,295		probably benign	Het
Skiv2l	T	C	17: 34,847,432	K192E	probably benign	Het
Slc34a3	T	A	2: 25,233,300		probably null	Het
Sspn	T	A	6: 145,961,226	C52S	probably damaging	Het
Strip1	T	C	3: 107,626,826	E164G	possibly damaging	Het
Sult5a1	A	C	8: 123,157,442	S47A	probably damaging	Het
Svep1	T	C	4: 58,091,964	D1557G	possibly damaging	Het
Tdrd6	T	C	17: 43,629,333	I275V	probably damaging	Het
Thada	C	T	17: 84,191,983	V1929I	probably benign	Het
Tmem132b	G	A	5: 125,623,352	R318Q	probably damaging	Het
Tmem176b	T	G	6: 48,834,070	I259L	probably benign	Het
Tmppe	C	A	9: 114,405,896	P421Q	possibly damaging	Het
Tmprss11e	G	A	5: 86,709,456	Q333*	probably null	Het
Tpcn2	T	A	7: 145,267,334	R328W	possibly damaging	Het
Trem1	C	T	17: 48,237,055	T36I	probably damaging	Het
Zfp319	A	G	8: 95,325,571		probably benign	Het

Other mutations in Trpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00730:Trpm2	APN	10	77942915	splice site	probably null
IGL00773:Trpm2	APN	10	77949214	nonsense	probably null
IGL00962:Trpm2	APN	10	77943916	splice site	probably benign
IGL01093:Trpm2	APN	10	77932280	missense	probably benign	0.04
IGL01124:Trpm2	APN	10	77945825	splice site	probably benign
IGL01301:Trpm2	APN	10	77923984	missense	probably damaging	1.00
IGL02094:Trpm2	APN	10	77942996	nonsense	probably null
IGL02175:Trpm2	APN	10	77937907	missense	probably benign	0.07
IGL02653:Trpm2	APN	10	77912669	missense	probably benign	0.19
IGL02667:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02668:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02828:Trpm2	APN	10	77918986	missense	probably benign	0.16
IGL02951:Trpm2	APN	10	77929278	missense	possibly damaging	0.95
IGL03188:Trpm2	APN	10	77918909	missense	probably benign	0.18
IGL03242:Trpm2	APN	10	77917734	missense	probably benign
IGL03405:Trpm2	APN	10	77966072	splice site	probably benign
Fugit	UTSW	10	77938368	missense	probably damaging	1.00
scusate	UTSW	10	77966994	nonsense	probably null
temporal	UTSW	10	77925682	missense	probably benign	0.30
ANU18:Trpm2	UTSW	10	77923984	missense	probably damaging	1.00
R0147:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0148:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0302:Trpm2	UTSW	10	77943990	splice site	probably benign
R0332:Trpm2	UTSW	10	77947988	missense	probably damaging	1.00
R0586:Trpm2	UTSW	10	77923516	missense	probably damaging	0.99
R0847:Trpm2	UTSW	10	77929288	missense	possibly damaging	0.94
R1183:Trpm2	UTSW	10	77923564	missense	probably damaging	1.00
R1472:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R1510:Trpm2	UTSW	10	77966994	nonsense	probably null
R1518:Trpm2	UTSW	10	77943005	missense	possibly damaging	0.67
R1564:Trpm2	UTSW	10	77942999	missense	probably benign	0.14
R1593:Trpm2	UTSW	10	77943076	missense	possibly damaging	0.71
R1617:Trpm2	UTSW	10	77935875	splice site	probably null
R1673:Trpm2	UTSW	10	77942944	missense	probably benign
R1912:Trpm2	UTSW	10	77945876	missense	probably benign	0.10
R1932:Trpm2	UTSW	10	77941158	missense	probably damaging	1.00
R1993:Trpm2	UTSW	10	77947989	missense	probably damaging	1.00
R2013:Trpm2	UTSW	10	77925766	missense	probably damaging	1.00
R2151:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R2201:Trpm2	UTSW	10	77920471	nonsense	probably null
R2217:Trpm2	UTSW	10	77941182	missense	probably damaging	1.00
R2312:Trpm2	UTSW	10	77918964	missense	probably benign	0.04
R2339:Trpm2	UTSW	10	77914806	splice site	probably benign
R2395:Trpm2	UTSW	10	77947880	missense	possibly damaging	0.69
R2396:Trpm2	UTSW	10	77930637	missense	probably benign	0.14
R2405:Trpm2	UTSW	10	77934724	missense	probably damaging	1.00
R2567:Trpm2	UTSW	10	77941174	missense	probably damaging	0.99
R3001:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3002:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3125:Trpm2	UTSW	10	77911374	missense	probably damaging	1.00
R3500:Trpm2	UTSW	10	77932302	missense	probably benign	0.03
R3777:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R3778:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R4272:Trpm2	UTSW	10	77933642	missense	probably damaging	1.00
R4384:Trpm2	UTSW	10	77917725	missense	probably benign	0.44
R4395:Trpm2	UTSW	10	77929219	missense	probably benign	0.01
R4423:Trpm2	UTSW	10	77935068	missense	probably benign	0.00
R4452:Trpm2	UTSW	10	77923593	missense	probably damaging	1.00
R4612:Trpm2	UTSW	10	77945916	missense	probably damaging	0.99
R4662:Trpm2	UTSW	10	77938138	missense	probably benign	0.05
R4825:Trpm2	UTSW	10	77941173	missense	probably damaging	0.98
R4906:Trpm2	UTSW	10	77932189	nonsense	probably null
R4943:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R4948:Trpm2	UTSW	10	77917792	missense	probably benign	0.34
R5046:Trpm2	UTSW	10	77966018	missense	probably damaging	1.00
R5320:Trpm2	UTSW	10	77923521	missense	probably benign	0.06
R5523:Trpm2	UTSW	10	77935961	missense	probably benign	0.04
R5562:Trpm2	UTSW	10	77959939	missense	possibly damaging	0.71
R5628:Trpm2	UTSW	10	77912636	missense	probably benign	0.00
R5633:Trpm2	UTSW	10	77938353	missense	possibly damaging	0.71
R5817:Trpm2	UTSW	10	77965980	missense	probably damaging	1.00
R5989:Trpm2	UTSW	10	77959900	missense	probably damaging	1.00
R6018:Trpm2	UTSW	10	77917713	missense	probably benign	0.00
R6075:Trpm2	UTSW	10	77935043	critical splice donor site	probably null
R6092:Trpm2	UTSW	10	77925682	missense	probably benign	0.30
R6309:Trpm2	UTSW	10	77938368	missense	probably damaging	1.00
R6327:Trpm2	UTSW	10	77932227	missense	probably damaging	1.00
R6568:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6579:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6640:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6642:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6798:Trpm2	UTSW	10	77914740	missense	probably damaging	0.99
R6999:Trpm2	UTSW	10	77935891	missense	probably damaging	1.00
R7034:Trpm2	UTSW	10	77912592	missense	probably benign
R7036:Trpm2	UTSW	10	77912592	missense	probably benign
R7113:Trpm2	UTSW	10	77947931	missense	probably damaging	0.96
R7171:Trpm2	UTSW	10	77924014	missense	probably damaging	1.00
R7240:Trpm2	UTSW	10	77935876	critical splice donor site	probably null
R7274:Trpm2	UTSW	10	77923555	missense	probably benign	0.00
R7379:Trpm2	UTSW	10	77914734	missense	probably benign
R7527:Trpm2	UTSW	10	77966060	missense	probably benign	0.01
R7571:Trpm2	UTSW	10	77937950	missense	probably benign	0.21
R7600:Trpm2	UTSW	10	77938051	missense	probably benign	0.02
R7727:Trpm2	UTSW	10	77925789	missense	probably benign	0.34
R7771:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R7844:Trpm2	UTSW	10	77923506	missense	probably benign	0.00
R8158:Trpm2	UTSW	10	77947897	missense	probably damaging	0.99
R8225:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8226:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8239:Trpm2	UTSW	10	77936002	missense	probably benign	0.06
R8275:Trpm2	UTSW	10	77966025	nonsense	probably null
R8340:Trpm2	UTSW	10	77923624	nonsense	probably null
R8354:Trpm2	UTSW	10	77933649	missense	probably damaging	1.00
R8427:Trpm2	UTSW	10	77911402	missense	possibly damaging	0.93
R8445:Trpm2	UTSW	10	77910252	missense	probably damaging	1.00
R8769:Trpm2	UTSW	10	77932294	missense	probably benign	0.00
R9144:Trpm2	UTSW	10	77929288	missense	probably benign	0.01
R9286:Trpm2	UTSW	10	77941180	missense	probably benign	0.06
R9319:Trpm2	UTSW	10	77942942	nonsense	probably null
R9319:Trpm2	UTSW	10	77949198	missense	probably damaging	1.00
R9381:Trpm2	UTSW	10	77911357	missense	possibly damaging	0.90
R9457:Trpm2	UTSW	10	77911392	missense	possibly damaging	0.82
R9477:Trpm2	UTSW	10	77911390	missense	probably benign	0.12
R9547:Trpm2	UTSW	10	77912633	missense	probably benign	0.33
R9660:Trpm2	UTSW	10	77930555	missense	probably benign	0.00
R9663:Trpm2	UTSW	10	77920486	missense	probably benign	0.01
Z1177:Trpm2	UTSW	10	77937868	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- ACCGGAATCTGAGGTCAATC -3'
(R):5'- TCTTCTGCAGGGAAAAGAGGC -3'

Sequencing Primer
(F):5'- CCGGAATCTGAGGTCAATCATGTG -3'
(R):5'- AGGCACTGTGTCGCCCAG -3'

Posted On

2016-11-08