Incidental Mutation 'R5623:Chrm3'
ID 441699
Institutional Source Beutler Lab
Gene Symbol Chrm3
Ensembl Gene ENSMUSG00000046159
Gene Name cholinergic receptor, muscarinic 3, cardiac
Synonyms muscarinic acetylcholine receptor 3, M3R, Chrm-3
MMRRC Submission 043162-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R5623 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 9925522-10410883 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 9927423 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 538 (V538L)
Ref Sequence ENSEMBL: ENSMUSP00000140131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063093] [ENSMUST00000187510]
AlphaFold Q9ERZ3
Predicted Effect possibly damaging
Transcript: ENSMUST00000063093
AA Change: V538L

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055579
Gene: ENSMUSG00000046159
AA Change: V538L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 75 265 8.9e-7 PFAM
Pfam:7TM_GPCR_Srsx 78 270 6e-11 PFAM
Pfam:7tm_1 84 543 6.9e-82 PFAM
low complexity region 564 576 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187510
AA Change: V538L

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140131
Gene: ENSMUSG00000046159
AA Change: V538L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 75 265 8.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 78 270 6e-11 PFAM
Pfam:7tm_1 84 543 2.6e-88 PFAM
low complexity region 564 576 N/A INTRINSIC
Meta Mutation Damage Score 0.1147 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 3 controls smooth muscle contraction and its stimulation causes secretion of glandular tissue. Alternative promoter use and alternative splicing results in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null mice show reduced body weight and gonadal fat pad weight, decreased food intake, and low serum levels of leptin, triglycerides and insulin. Dilated pupils, hydronephrosis, and impaired contractility of smooth muscle are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b1 T G 18: 64,679,165 (GRCm39) Q772P possibly damaging Het
B3gnt2 C G 11: 22,787,018 (GRCm39) A57P probably damaging Het
Birc6 T G 17: 74,835,651 (GRCm39) D63E probably damaging Het
Ccdc13 T C 9: 121,662,799 (GRCm39) E72G probably damaging Het
Cfap221 C T 1: 119,881,898 (GRCm39) A297T probably benign Het
Chd1 T A 17: 15,975,194 (GRCm39) N1081K probably damaging Het
Clec16a T A 16: 10,428,985 (GRCm39) N37K probably benign Het
Cnksr3 T A 10: 7,070,548 (GRCm39) I229F probably damaging Het
Cspg4b T C 13: 113,483,168 (GRCm39) I1590T possibly damaging Het
Dchs1 T C 7: 105,421,976 (GRCm39) E148G probably damaging Het
Diaph1 A T 18: 38,029,146 (GRCm39) probably benign Het
Dis3l A G 9: 64,214,885 (GRCm39) F895L possibly damaging Het
Dnah1 G T 14: 31,007,980 (GRCm39) D2142E possibly damaging Het
Dst T C 1: 34,229,214 (GRCm39) V1944A possibly damaging Het
Eif4a2 C T 16: 22,928,969 (GRCm39) probably benign Het
Ephb6 T A 6: 41,593,415 (GRCm39) M487K probably benign Het
Fgf18 T G 11: 33,084,272 (GRCm39) T61P probably damaging Het
G6pc2 A G 2: 69,056,927 (GRCm39) E191G probably damaging Het
Gm10717 C T 9: 3,026,318 (GRCm39) S55L probably benign Het
Gm5414 A G 15: 101,534,246 (GRCm39) F286S probably damaging Het
Gpcpd1 G T 2: 132,376,637 (GRCm39) A553E probably damaging Het
Gpr153 A G 4: 152,366,398 (GRCm39) D321G possibly damaging Het
Hecw2 T A 1: 53,871,782 (GRCm39) Q1388L probably null Het
Ighv14-3 A C 12: 114,023,710 (GRCm39) S36A probably damaging Het
Inpp5j C A 11: 3,444,766 (GRCm39) G969V probably damaging Het
Kat5 G A 19: 5,657,590 (GRCm39) R307W probably damaging Het
Klk1b21 A G 7: 43,754,989 (GRCm39) S95G probably damaging Het
Mdm1 G A 10: 117,986,694 (GRCm39) V171I possibly damaging Het
Nfu1 TCGC T 6: 86,993,188 (GRCm39) probably benign Het
Or5k8 C T 16: 58,644,706 (GRCm39) R122H probably benign Het
Or6c206 G A 10: 129,096,901 (GRCm39) V24M probably benign Het
Phkb T A 8: 86,569,677 (GRCm39) probably benign Het
Pkd1l3 A T 8: 110,350,351 (GRCm39) T399S possibly damaging Het
Prr14l A T 5: 33,001,852 (GRCm39) probably benign Het
Psg21 A C 7: 18,388,939 (GRCm39) L51R probably damaging Het
Ptprg T A 14: 12,153,857 (GRCm38) I526N probably damaging Het
Rab1a T C 11: 20,151,626 (GRCm39) probably benign Het
Rims2 A T 15: 39,342,011 (GRCm39) Q620L probably damaging Het
Rnf215 T G 11: 4,085,453 (GRCm39) S58A probably benign Het
Scaper A C 9: 55,771,791 (GRCm39) V375G probably benign Het
Sgk3 A T 1: 9,872,520 (GRCm39) probably benign Het
Skic2 T C 17: 35,066,408 (GRCm39) K192E probably benign Het
Slc34a3 T A 2: 25,123,312 (GRCm39) probably null Het
Sspn T A 6: 145,906,952 (GRCm39) C52S probably damaging Het
Strip1 T C 3: 107,534,142 (GRCm39) E164G possibly damaging Het
Sult5a1 A C 8: 123,884,181 (GRCm39) S47A probably damaging Het
Svep1 T C 4: 58,091,964 (GRCm39) D1557G possibly damaging Het
Tdrd6 T C 17: 43,940,224 (GRCm39) I275V probably damaging Het
Thada C T 17: 84,499,411 (GRCm39) V1929I probably benign Het
Tmem132b G A 5: 125,700,416 (GRCm39) R318Q probably damaging Het
Tmem176b T G 6: 48,811,004 (GRCm39) I259L probably benign Het
Tmppe C A 9: 114,234,964 (GRCm39) P421Q possibly damaging Het
Tmprss11e G A 5: 86,857,315 (GRCm39) Q333* probably null Het
Tpcn2 T A 7: 144,821,071 (GRCm39) R328W possibly damaging Het
Trem1 C T 17: 48,544,083 (GRCm39) T36I probably damaging Het
Trpm2 C A 10: 77,767,973 (GRCm39) R842L probably damaging Het
Zfp319 A G 8: 96,052,199 (GRCm39) probably benign Het
Other mutations in Chrm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Chrm3 APN 13 9,928,634 (GRCm39) missense possibly damaging 0.80
IGL02266:Chrm3 APN 13 9,927,314 (GRCm39) missense probably damaging 0.99
IGL02701:Chrm3 APN 13 9,928,500 (GRCm39) nonsense probably null
IGL03085:Chrm3 APN 13 9,927,570 (GRCm39) missense probably damaging 1.00
IGL03213:Chrm3 APN 13 9,928,220 (GRCm39) missense probably benign 0.22
R0147:Chrm3 UTSW 13 9,928,780 (GRCm39) missense probably damaging 1.00
R0408:Chrm3 UTSW 13 9,927,969 (GRCm39) missense probably benign 0.10
R0544:Chrm3 UTSW 13 9,927,615 (GRCm39) missense probably damaging 0.99
R1557:Chrm3 UTSW 13 9,928,350 (GRCm39) missense possibly damaging 0.82
R1647:Chrm3 UTSW 13 9,928,461 (GRCm39) missense probably damaging 1.00
R1697:Chrm3 UTSW 13 9,928,794 (GRCm39) missense probably damaging 1.00
R1791:Chrm3 UTSW 13 9,927,452 (GRCm39) missense probably damaging 1.00
R1866:Chrm3 UTSW 13 9,928,517 (GRCm39) missense probably damaging 1.00
R2049:Chrm3 UTSW 13 9,928,371 (GRCm39) missense probably damaging 1.00
R2909:Chrm3 UTSW 13 9,928,033 (GRCm39) missense probably benign 0.43
R4212:Chrm3 UTSW 13 9,927,791 (GRCm39) missense probably benign 0.01
R4422:Chrm3 UTSW 13 9,928,591 (GRCm39) nonsense probably null
R4790:Chrm3 UTSW 13 9,927,698 (GRCm39) missense probably benign 0.10
R4934:Chrm3 UTSW 13 9,927,450 (GRCm39) missense probably damaging 1.00
R5353:Chrm3 UTSW 13 9,928,593 (GRCm39) missense probably damaging 1.00
R6154:Chrm3 UTSW 13 9,928,476 (GRCm39) missense possibly damaging 0.88
R6416:Chrm3 UTSW 13 9,927,698 (GRCm39) missense probably benign
R6693:Chrm3 UTSW 13 9,927,458 (GRCm39) missense probably benign 0.27
R7135:Chrm3 UTSW 13 9,927,837 (GRCm39) missense probably benign 0.00
R7297:Chrm3 UTSW 13 9,927,869 (GRCm39) missense probably benign 0.01
R7423:Chrm3 UTSW 13 9,928,845 (GRCm39) missense probably benign
R7591:Chrm3 UTSW 13 9,927,349 (GRCm39) nonsense probably null
R8353:Chrm3 UTSW 13 9,927,267 (GRCm39) makesense probably null
R8355:Chrm3 UTSW 13 9,928,646 (GRCm39) missense probably damaging 1.00
R8446:Chrm3 UTSW 13 9,928,338 (GRCm39) missense probably damaging 0.99
R8453:Chrm3 UTSW 13 9,927,267 (GRCm39) makesense probably null
R9227:Chrm3 UTSW 13 9,928,479 (GRCm39) missense probably benign 0.00
R9230:Chrm3 UTSW 13 9,928,479 (GRCm39) missense probably benign 0.00
R9336:Chrm3 UTSW 13 9,928,652 (GRCm39) missense probably damaging 1.00
R9462:Chrm3 UTSW 13 9,927,437 (GRCm39) missense
R9537:Chrm3 UTSW 13 9,927,462 (GRCm39) missense probably damaging 1.00
R9586:Chrm3 UTSW 13 9,927,480 (GRCm39) missense probably damaging 1.00
X0066:Chrm3 UTSW 13 9,927,756 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACCCCTTTTCTACAAGGCC -3'
(R):5'- ACGCTGGCTAAGAGGTTTGC -3'

Sequencing Primer
(F):5'- TTTCTACAAGGCCTGCTCAG -3'
(R):5'- AGGTTTGCTCTCAAGACCAG -3'
Posted On 2016-11-08