Incidental Mutation 'R5623:BC067074'
ID441700
Institutional Source Beutler Lab
Gene Symbol BC067074
Ensembl Gene ENSMUSG00000021763
Gene NamecDNA sequence BC067074
Synonyms
MMRRC Submission 043162-MU
Accession Numbers

Ncbi RefSeq: none; VEGA: OTTMUST00000084794; MGI:3040697

Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R5623 (G1)
Quality Score142
Status Validated
Chromosome13
Chromosomal Location113293159-113379711 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113346634 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1590 (I1590T)
Ref Sequence ENSEMBL: ENSMUSP00000119993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078163] [ENSMUST00000136755]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078163
AA Change: I48T

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077297
Gene: ENSMUSG00000021763
AA Change: I48T

DomainStartEndE-ValueType
Pfam:Cadherin_3 29 136 4.6e-12 PFAM
low complexity region 190 198 N/A INTRINSIC
Pfam:Cadherin_3 231 384 4.9e-38 PFAM
transmembrane domain 725 747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135096
SMART Domains Protein: ENSMUSP00000131959
Gene: ENSMUSG00000021763

DomainStartEndE-ValueType
Pfam:Cadherin_3 1 86 1.1e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000136755
AA Change: I1590T

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119993
Gene: ENSMUSG00000021763
AA Change: I1590T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LamG 44 177 1.28e-20 SMART
LamG 229 371 4.66e-14 SMART
low complexity region 407 420 N/A INTRINSIC
Pfam:Cadherin_3 492 644 2.1e-35 PFAM
Pfam:Cadherin_3 647 759 1e-7 PFAM
Pfam:Cadherin_3 741 873 1.2e-8 PFAM
Pfam:Cadherin_3 861 989 4.1e-14 PFAM
Pfam:Cadherin_3 958 1114 1.2e-20 PFAM
Pfam:Cadherin_3 1117 1223 1.6e-10 PFAM
Pfam:Cadherin_3 1212 1341 5.6e-12 PFAM
Pfam:Cadherin_3 1347 1438 3.8e-8 PFAM
Pfam:Cadherin_3 1419 1562 2.3e-45 PFAM
Pfam:Cadherin_3 1576 1679 2.1e-9 PFAM
low complexity region 1732 1740 N/A INTRINSIC
Pfam:Cadherin_3 1773 1926 3e-35 PFAM
transmembrane domain 2267 2289 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (65/66)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b1 T G 18: 64,546,094 Q772P possibly damaging Het
B3gnt2 C G 11: 22,837,018 A57P probably damaging Het
Birc6 T G 17: 74,528,656 D63E probably damaging Het
Ccdc13 T C 9: 121,833,733 E72G probably damaging Het
Cfap221 C T 1: 119,954,168 A297T probably benign Het
Chd1 T A 17: 15,754,932 N1081K probably damaging Het
Chrm3 C A 13: 9,877,387 V538L possibly damaging Het
Clec16a T A 16: 10,611,121 N37K probably benign Het
Cnksr3 T A 10: 7,120,548 I229F probably damaging Het
Dchs1 T C 7: 105,772,769 E148G probably damaging Het
Diaph1 A T 18: 37,896,093 probably benign Het
Dis3l A G 9: 64,307,603 F895L possibly damaging Het
Dnah1 G T 14: 31,286,023 D2142E possibly damaging Het
Dst T C 1: 34,190,133 V1944A possibly damaging Het
Eif4a2 C T 16: 23,110,219 probably benign Het
Ephb6 T A 6: 41,616,481 M487K probably benign Het
Fgf18 T G 11: 33,134,272 T61P probably damaging Het
G6pc2 A G 2: 69,226,583 E191G probably damaging Het
Gm10717 C T 9: 3,026,318 S55L probably benign Het
Gm5414 A G 15: 101,625,811 F286S probably damaging Het
Gpcpd1 G T 2: 132,534,717 A553E probably damaging Het
Gpr153 A G 4: 152,281,941 D321G possibly damaging Het
Hecw2 T A 1: 53,832,623 Q1388L probably null Het
Ighv14-3 A C 12: 114,060,090 S36A probably damaging Het
Inpp5j C A 11: 3,494,766 G969V probably damaging Het
Kat5 G A 19: 5,607,562 R307W probably damaging Het
Klk1b21 A G 7: 44,105,565 S95G probably damaging Het
Mdm1 G A 10: 118,150,789 V171I possibly damaging Het
Nfu1 TCGC T 6: 87,016,206 probably benign Het
Olfr175-ps1 C T 16: 58,824,343 R122H probably benign Het
Olfr776 G A 10: 129,261,032 V24M probably benign Het
Phkb T A 8: 85,843,048 probably benign Het
Pkd1l3 A T 8: 109,623,719 T399S possibly damaging Het
Prr14l A T 5: 32,844,508 probably benign Het
Psg21 A C 7: 18,655,014 L51R probably damaging Het
Ptprg T A 14: 12,153,857 I526N probably damaging Het
Rab1a T C 11: 20,201,626 probably benign Het
Rims2 A T 15: 39,478,615 Q620L probably damaging Het
Rnf215 T G 11: 4,135,453 S58A probably benign Het
Scaper A C 9: 55,864,507 V375G probably benign Het
Sgk3 A T 1: 9,802,295 probably benign Het
Skiv2l T C 17: 34,847,432 K192E probably benign Het
Slc34a3 T A 2: 25,233,300 probably null Het
Sspn T A 6: 145,961,226 C52S probably damaging Het
Strip1 T C 3: 107,626,826 E164G possibly damaging Het
Sult5a1 A C 8: 123,157,442 S47A probably damaging Het
Svep1 T C 4: 58,091,964 D1557G possibly damaging Het
Tdrd6 T C 17: 43,629,333 I275V probably damaging Het
Thada C T 17: 84,191,983 V1929I probably benign Het
Tmem132b G A 5: 125,623,352 R318Q probably damaging Het
Tmem176b T G 6: 48,834,070 I259L probably benign Het
Tmppe C A 9: 114,405,896 P421Q possibly damaging Het
Tmprss11e G A 5: 86,709,456 Q333* probably null Het
Tpcn2 T A 7: 145,267,334 R328W possibly damaging Het
Trem1 C T 17: 48,237,055 T36I probably damaging Het
Trpm2 C A 10: 77,932,139 R842L probably damaging Het
Zfp319 A G 8: 95,325,571 probably benign Het
Other mutations in BC067074
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:BC067074 APN 13 113367557 missense possibly damaging 0.91
IGL03023:BC067074 APN 13 113351741 missense probably benign 0.03
cumpleanos UTSW 13 113368336 missense possibly damaging 0.87
Sorpresa UTSW 13 113318191 missense probably damaging 1.00
P0018:BC067074 UTSW 13 113367506 missense possibly damaging 0.60
R0003:BC067074 UTSW 13 113368776 missense probably benign 0.00
R0016:BC067074 UTSW 13 113366105 missense probably damaging 1.00
R0016:BC067074 UTSW 13 113366105 missense probably damaging 1.00
R0053:BC067074 UTSW 13 113368489 missense probably benign 0.00
R0053:BC067074 UTSW 13 113368489 missense probably benign 0.00
R0158:BC067074 UTSW 13 113369153 nonsense probably null
R0281:BC067074 UTSW 13 113369143 missense probably damaging 1.00
R1212:BC067074 UTSW 13 113369417 intron probably benign
R1300:BC067074 UTSW 13 113366160 missense probably damaging 1.00
R1434:BC067074 UTSW 13 113368492 missense possibly damaging 0.46
R1509:BC067074 UTSW 13 113368256 missense probably damaging 0.99
R1738:BC067074 UTSW 13 113367500 missense possibly damaging 0.69
R1758:BC067074 UTSW 13 113368732 missense possibly damaging 0.78
R1828:BC067074 UTSW 13 113368808 missense probably damaging 1.00
R2061:BC067074 UTSW 13 113318094 missense probably damaging 0.99
R2570:BC067074 UTSW 13 113318587 missense probably benign 0.34
R2884:BC067074 UTSW 13 113320682 missense probably damaging 1.00
R2884:BC067074 UTSW 13 113369191 missense probably benign 0.00
R3004:BC067074 UTSW 13 113366154 missense probably damaging 1.00
R3150:BC067074 UTSW 13 113351760 missense probably damaging 1.00
R3773:BC067074 UTSW 13 113318209 missense probably benign 0.12
R3864:BC067074 UTSW 13 113322951 missense possibly damaging 0.64
R3971:BC067074 UTSW 13 113317126 missense probably damaging 1.00
R4004:BC067074 UTSW 13 113318380 missense probably benign 0.00
R4271:BC067074 UTSW 13 113342370 missense possibly damaging 0.76
R4382:BC067074 UTSW 13 113322754 missense probably benign 0.10
R4484:BC067074 UTSW 13 113319199 missense probably damaging 0.98
R4570:BC067074 UTSW 13 113318191 missense probably damaging 1.00
R4600:BC067074 UTSW 13 113319249 missense possibly damaging 0.95
R4622:BC067074 UTSW 13 113320081 missense probably benign 0.00
R4676:BC067074 UTSW 13 113368807 missense probably damaging 0.98
R4676:BC067074 UTSW 13 113368808 missense probably damaging 1.00
R4677:BC067074 UTSW 13 113379486 missense unknown
R4775:BC067074 UTSW 13 113317695 missense possibly damaging 0.91
R4779:BC067074 UTSW 13 113368336 missense possibly damaging 0.87
R4780:BC067074 UTSW 13 113317858 missense probably damaging 1.00
R4829:BC067074 UTSW 13 113368162 missense probably benign 0.05
R4841:BC067074 UTSW 13 113366190 missense probably benign 0.00
R4879:BC067074 UTSW 13 113319787 missense probably benign 0.03
R4930:BC067074 UTSW 13 113327662 missense probably damaging 1.00
R4934:BC067074 UTSW 13 113368348 missense probably damaging 1.00
R4987:BC067074 UTSW 13 113318101 missense probably benign 0.07
R5065:BC067074 UTSW 13 113320919 missense probably benign 0.01
R5216:BC067074 UTSW 13 113342413 missense probably benign 0.20
R5236:BC067074 UTSW 13 113366220 missense probably benign 0.14
R5247:BC067074 UTSW 13 113319459 missense probably damaging 1.00
R5250:BC067074 UTSW 13 113319771 missense possibly damaging 0.95
R5337:BC067074 UTSW 13 113318765 missense probably damaging 1.00
R5342:BC067074 UTSW 13 113366269 critical splice donor site probably null
R5426:BC067074 UTSW 13 113369053 missense probably benign 0.01
R5472:BC067074 UTSW 13 113319169 missense probably benign 0.12
R5526:BC067074 UTSW 13 113367893 missense probably benign 0.22
R5543:BC067074 UTSW 13 113320873 missense probably damaging 0.96
R5589:BC067074 UTSW 13 113317950 missense possibly damaging 0.95
R5668:BC067074 UTSW 13 113317167 missense possibly damaging 0.55
R5793:BC067074 UTSW 13 113321022 missense possibly damaging 0.75
R5824:BC067074 UTSW 13 113368620 missense probably damaging 1.00
R6038:BC067074 UTSW 13 113318619 missense possibly damaging 0.49
R6038:BC067074 UTSW 13 113318619 missense possibly damaging 0.49
R6053:BC067074 UTSW 13 113320726 missense possibly damaging 0.51
R6125:BC067074 UTSW 13 113317683 missense probably benign 0.00
R6129:BC067074 UTSW 13 113368806 nonsense probably null
R6290:BC067074 UTSW 13 113319958 missense probably damaging 0.97
R6291:BC067074 UTSW 13 113320447 missense possibly damaging 0.85
R6302:BC067074 UTSW 13 113368112 missense probably damaging 1.00
R6317:BC067074 UTSW 13 113368268 missense probably benign 0.09
R6395:BC067074 UTSW 13 113369469 missense probably damaging 1.00
R6673:BC067074 UTSW 13 113367832 nonsense probably null
R6783:BC067074 UTSW 13 113320209 nonsense probably null
R6800:BC067074 UTSW 13 113368152 missense probably benign 0.02
R6857:BC067074 UTSW 13 113319958 missense probably damaging 0.97
R6889:BC067074 UTSW 13 113318378 missense probably damaging 0.99
R6934:BC067074 UTSW 13 113369266 missense probably benign
R7019:BC067074 UTSW 13 113351750 missense probably benign 0.01
R7100:BC067074 UTSW 13 113318967 missense
R7115:BC067074 UTSW 13 113320776 missense
R7152:BC067074 UTSW 13 113318850 missense
R7195:BC067074 UTSW 13 113367929 missense
R7213:BC067074 UTSW 13 113317941 missense
R7250:BC067074 UTSW 13 113318815 missense
R7341:BC067074 UTSW 13 113318172 missense
R7358:BC067074 UTSW 13 113319967 missense
R7359:BC067074 UTSW 13 113342430 missense
R7396:BC067074 UTSW 13 113318990 missense
R7632:BC067074 UTSW 13 113320886 missense
R7689:BC067074 UTSW 13 113379414 missense
R7713:BC067074 UTSW 13 113346541 missense
Predicted Primers PCR Primer
(F):5'- TAATTCAGCAAGCTCAGTGGG -3'
(R):5'- GCTGCTGTCAAATTTCTGCTG -3'

Sequencing Primer
(F):5'- TCAGCAAGCTCAGTGGGTAATTAAC -3'
(R):5'- GCTGTCAAATTTCTGCTGAGAATTC -3'
Posted On2016-11-08