Incidental Mutation 'R5623:Chd1'
ID441708
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Namechromodomain helicase DNA binding protein 1
Synonyms4930525N21Rik
MMRRC Submission 043162-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5623 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location15704967-15772610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15754932 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1081 (N1081K)
Ref Sequence ENSEMBL: ENSMUSP00000024627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627] [ENSMUST00000173311]
Predicted Effect probably damaging
Transcript: ENSMUST00000024627
AA Change: N1081K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: N1081K

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173040
SMART Domains Protein: ENSMUSP00000133406
Gene: ENSMUSG00000023852

DomainStartEndE-ValueType
Blast:DEXDc 2 102 5e-58 BLAST
PDB:4B4C|A 2 153 1e-108 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000173311
SMART Domains Protein: ENSMUSP00000134091
Gene: ENSMUSG00000023852

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1078 2e-38 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000174461
AA Change: N465K
SMART Domains Protein: ENSMUSP00000134718
Gene: ENSMUSG00000023852
AA Change: N465K

DomainStartEndE-ValueType
Pfam:SNF2_N 1 148 3.6e-34 PFAM
low complexity region 172 184 N/A INTRINSIC
HELICc 201 285 8.48e-25 SMART
Blast:DEXDc 340 516 1e-47 BLAST
Meta Mutation Damage Score 0.0984 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b1 T G 18: 64,546,094 Q772P possibly damaging Het
B3gnt2 C G 11: 22,837,018 A57P probably damaging Het
BC067074 T C 13: 113,346,634 I1590T possibly damaging Het
Birc6 T G 17: 74,528,656 D63E probably damaging Het
Ccdc13 T C 9: 121,833,733 E72G probably damaging Het
Cfap221 C T 1: 119,954,168 A297T probably benign Het
Chrm3 C A 13: 9,877,387 V538L possibly damaging Het
Clec16a T A 16: 10,611,121 N37K probably benign Het
Cnksr3 T A 10: 7,120,548 I229F probably damaging Het
Dchs1 T C 7: 105,772,769 E148G probably damaging Het
Diaph1 A T 18: 37,896,093 probably benign Het
Dis3l A G 9: 64,307,603 F895L possibly damaging Het
Dnah1 G T 14: 31,286,023 D2142E possibly damaging Het
Dst T C 1: 34,190,133 V1944A possibly damaging Het
Eif4a2 C T 16: 23,110,219 probably benign Het
Ephb6 T A 6: 41,616,481 M487K probably benign Het
Fgf18 T G 11: 33,134,272 T61P probably damaging Het
G6pc2 A G 2: 69,226,583 E191G probably damaging Het
Gm10717 C T 9: 3,026,318 S55L probably benign Het
Gm5414 A G 15: 101,625,811 F286S probably damaging Het
Gpcpd1 G T 2: 132,534,717 A553E probably damaging Het
Gpr153 A G 4: 152,281,941 D321G possibly damaging Het
Hecw2 T A 1: 53,832,623 Q1388L probably null Het
Ighv14-3 A C 12: 114,060,090 S36A probably damaging Het
Inpp5j C A 11: 3,494,766 G969V probably damaging Het
Kat5 G A 19: 5,607,562 R307W probably damaging Het
Klk1b21 A G 7: 44,105,565 S95G probably damaging Het
Mdm1 G A 10: 118,150,789 V171I possibly damaging Het
Nfu1 TCGC T 6: 87,016,206 probably benign Het
Olfr175-ps1 C T 16: 58,824,343 R122H probably benign Het
Olfr776 G A 10: 129,261,032 V24M probably benign Het
Phkb T A 8: 85,843,048 probably benign Het
Pkd1l3 A T 8: 109,623,719 T399S possibly damaging Het
Prr14l A T 5: 32,844,508 probably benign Het
Psg21 A C 7: 18,655,014 L51R probably damaging Het
Ptprg T A 14: 12,153,857 I526N probably damaging Het
Rab1a T C 11: 20,201,626 probably benign Het
Rims2 A T 15: 39,478,615 Q620L probably damaging Het
Rnf215 T G 11: 4,135,453 S58A probably benign Het
Scaper A C 9: 55,864,507 V375G probably benign Het
Sgk3 A T 1: 9,802,295 probably benign Het
Skiv2l T C 17: 34,847,432 K192E probably benign Het
Slc34a3 T A 2: 25,233,300 probably null Het
Sspn T A 6: 145,961,226 C52S probably damaging Het
Strip1 T C 3: 107,626,826 E164G possibly damaging Het
Sult5a1 A C 8: 123,157,442 S47A probably damaging Het
Svep1 T C 4: 58,091,964 D1557G possibly damaging Het
Tdrd6 T C 17: 43,629,333 I275V probably damaging Het
Thada C T 17: 84,191,983 V1929I probably benign Het
Tmem132b G A 5: 125,623,352 R318Q probably damaging Het
Tmem176b T G 6: 48,834,070 I259L probably benign Het
Tmppe C A 9: 114,405,896 P421Q possibly damaging Het
Tmprss11e G A 5: 86,709,456 Q333* probably null Het
Tpcn2 T A 7: 145,267,334 R328W possibly damaging Het
Trem1 C T 17: 48,237,055 T36I probably damaging Het
Trpm2 C A 10: 77,932,139 R842L probably damaging Het
Zfp319 A G 8: 95,325,571 probably benign Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15732565 missense probably benign 0.37
IGL01356:Chd1 APN 17 15749865 missense probably damaging 1.00
IGL01369:Chd1 APN 17 15754997 missense probably damaging 0.97
IGL01519:Chd1 APN 17 17378569 missense probably damaging 1.00
IGL01604:Chd1 APN 17 15770097 missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17378596 missense probably damaging 1.00
IGL01721:Chd1 APN 17 15770168 missense probably damaging 1.00
IGL01959:Chd1 APN 17 15742173 missense probably damaging 1.00
IGL02367:Chd1 APN 17 17390053 missense probably damaging 0.98
IGL02476:Chd1 APN 17 15734273 missense probably damaging 1.00
IGL02756:Chd1 APN 17 15730807 missense probably damaging 0.97
IGL02817:Chd1 APN 17 15749500 missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15770298 missense probably benign 0.22
IGL03108:Chd1 APN 17 15725281 missense possibly damaging 0.70
Holly UTSW 17 15726283 missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0128:Chd1 UTSW 17 17393567 missense probably damaging 1.00
R0197:Chd1 UTSW 17 15725431 missense probably benign
R0285:Chd1 UTSW 17 17374680 splice site probably benign
R0326:Chd1 UTSW 17 15768566 missense probably damaging 1.00
R0326:Chd1 UTSW 17 15768568 missense probably benign
R0372:Chd1 UTSW 17 17387290 missense probably benign 0.14
R0391:Chd1 UTSW 17 15749894 missense probably damaging 1.00
R0486:Chd1 UTSW 17 15734342 missense probably damaging 0.99
R0637:Chd1 UTSW 17 15742288 missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15758261 unclassified probably benign
R0701:Chd1 UTSW 17 15725431 missense probably benign
R0788:Chd1 UTSW 17 15707114 missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15770241 missense probably damaging 1.00
R0883:Chd1 UTSW 17 15725431 missense probably benign
R1169:Chd1 UTSW 17 15735732 missense probably damaging 1.00
R1218:Chd1 UTSW 17 15725312 missense probably damaging 1.00
R1370:Chd1 UTSW 17 17387480 missense probably benign 0.00
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15739507 missense probably damaging 0.99
R1752:Chd1 UTSW 17 15743232 critical splice donor site probably null
R1759:Chd1 UTSW 17 17387271 missense probably benign 0.00
R1767:Chd1 UTSW 17 15770303 missense probably damaging 1.00
R1938:Chd1 UTSW 17 15762486 missense probably benign 0.39
R2007:Chd1 UTSW 17 15731006 missense probably damaging 1.00
R2069:Chd1 UTSW 17 15742294 missense probably damaging 1.00
R3771:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3773:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3849:Chd1 UTSW 17 15731871 missense probably damaging 1.00
R4241:Chd1 UTSW 17 15770027 nonsense probably null
R4242:Chd1 UTSW 17 15770027 nonsense probably null
R4354:Chd1 UTSW 17 17390001 missense probably benign 0.23
R4468:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4469:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4731:Chd1 UTSW 17 17377817 missense probably benign 0.36
R4824:Chd1 UTSW 17 15733124 missense probably damaging 1.00
R4840:Chd1 UTSW 17 15768753 nonsense probably null
R4840:Chd1 UTSW 17 15768754 missense probably damaging 1.00
R4880:Chd1 UTSW 17 17374654 missense probably damaging 1.00
R4960:Chd1 UTSW 17 15742231 missense probably damaging 0.96
R5071:Chd1 UTSW 17 15762405 missense probably benign
R5078:Chd1 UTSW 17 15726354 missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15728198 missense probably benign 0.25
R5268:Chd1 UTSW 17 15735743 missense probably damaging 1.00
R5304:Chd1 UTSW 17 15754951 missense probably benign 0.01
R5304:Chd1 UTSW 17 15770268 missense possibly damaging 0.55
R5307:Chd1 UTSW 17 15732570 missense probably damaging 1.00
R5458:Chd1 UTSW 17 15738549 missense probably damaging 1.00
R5553:Chd1 UTSW 17 17385613 missense probably benign 0.17
R6022:Chd1 UTSW 17 17377773 missense probably benign 0.39
R6137:Chd1 UTSW 17 15758688 missense probably damaging 1.00
R6257:Chd1 UTSW 17 15730203 splice site probably null
R6373:Chd1 UTSW 17 15738636 missense probably damaging 1.00
R6458:Chd1 UTSW 17 15730602 missense probably benign 0.01
R6476:Chd1 UTSW 17 17380988 critical splice donor site probably null
R6508:Chd1 UTSW 17 15738633 missense probably benign 0.31
R6553:Chd1 UTSW 17 15725430 missense probably benign 0.00
R6745:Chd1 UTSW 17 17387167 missense probably benign 0.08
R7107:Chd1 UTSW 17 15761366 missense probably damaging 0.98
R7230:Chd1 UTSW 17 15706937 splice site probably null
R7317:Chd1 UTSW 17 15742274 missense possibly damaging 0.71
R7341:Chd1 UTSW 17 15770237 missense probably damaging 0.99
R7421:Chd1 UTSW 17 15749398 missense probably benign 0.03
R7704:Chd1 UTSW 17 15767475 missense probably benign
R7763:Chd1 UTSW 17 15733041 missense probably damaging 1.00
R8156:Chd1 UTSW 17 15761404 missense probably benign
R8194:Chd1 UTSW 17 17374475 start gained probably benign
R8261:Chd1 UTSW 17 17387542 missense probably benign 0.02
R8338:Chd1 UTSW 17 15769980 missense probably damaging 1.00
R8401:Chd1 UTSW 17 15743211 missense probably damaging 1.00
R8411:Chd1 UTSW 17 15762449 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15766347 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15768733 missense probably damaging 1.00
Z1177:Chd1 UTSW 17 15747801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGCCAGTTAGTAGCCATTATC -3'
(R):5'- GAAAGTGGTCTGTGTCCTCTTAC -3'

Sequencing Primer
(F):5'- TGGAACTCCCTTTGTAGACCAGG -3'
(R):5'- TACCGCCGAATCTCCGC -3'
Posted On2016-11-08