Incidental Mutation 'R5624:Il10'
ID441716
Institutional Source Beutler Lab
Gene Symbol Il10
Ensembl Gene ENSMUSG00000016529
Gene Nameinterleukin 10
SynonymsIL-10, cytokine synthesis inhibitory factor
MMRRC Submission 043163-MU
Accession Numbers

Ncbi RefSeq: NM_010548.2; MGI:96537

Is this an essential gene? Probably essential (E-score: 0.841) question?
Stock #R5624 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location131019845-131024974 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131024203 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 158 (M158V)
Ref Sequence ENSEMBL: ENSMUSP00000016673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016673]
PDB Structure
X-ray structure of mouse interleukin-10 mutant - S1_E8del, C149Y [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000016673
AA Change: M158V

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000016673
Gene: ENSMUSG00000016529
AA Change: M158V

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
IL10 37 173 1.05e-103 SMART
Meta Mutation Damage Score 0.3151 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (47/48)
MGI Phenotype Strain: 1857199; 3521569
FUNCTION: This gene encodes an anti-inflammatory cytokine that is a member of the class-2 cytokine family. The encoded protein is secreted by cells of both the innate and adaptive immune systems and is crucial for limiting the immune response to a broad range of pathogens. It also has been shown to suppress autoimmune responses. This protein mediates it's immunosuppressive signal through a specific interleukin 10 receptor complex. Aberrant functioning of this gene is associated with numerous immune disorders including graft-versus-host disease, and increased susceptibility to HIV-1 infection and rheumatoid arthritis. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit retarded growth, anemia, chronic enterocolitis, a high incidence of colorectal adenocarcinomas, and altered responses to various infectious organisms such as Mycobacterium bovis and Leishmania donovani. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted(14

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T A 8: 119,615,105 probably null Het
Aoah A T 13: 20,995,479 N372I probably damaging Het
Ash1l T A 3: 88,985,609 D1598E probably damaging Het
Bcas2 T C 3: 103,173,261 C72R probably benign Het
Car9 T A 4: 43,509,146 F238Y probably benign Het
Ccnd1 T C 7: 144,938,012 S97G probably benign Het
Cfap52 C G 11: 67,927,358 C509S possibly damaging Het
Clcn4 C A 7: 7,288,944 V623L probably benign Het
Dnajc11 T C 4: 151,979,510 V483A probably benign Het
E2f8 G T 7: 48,877,961 D144E probably damaging Het
Epb41l1 G A 2: 156,533,771 probably benign Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam208b A G 13: 3,584,996 S604P possibly damaging Het
Fhit A G 14: 10,421,534 S85P probably damaging Het
Fzd8 G A 18: 9,213,268 G117S unknown Het
Gsdmc4 A G 15: 63,892,654 M379T possibly damaging Het
Hemk1 T C 9: 107,331,528 R157G probably benign Het
Jmjd1c G A 10: 67,233,414 M1656I probably damaging Het
Kit A T 5: 75,609,394 K155N probably benign Het
Lmtk3 C A 7: 45,786,862 A114E probably damaging Het
Lztr1 A G 16: 17,512,129 probably benign Het
Mras A G 9: 99,411,485 F34S probably damaging Het
Myo1c A G 11: 75,662,635 T516A probably damaging Het
Nme8 A C 13: 19,677,868 V197G possibly damaging Het
Olfr1089 T C 2: 86,732,805 D269G probably benign Het
Olfr1339 T A 4: 118,735,371 Y281N probably damaging Het
Pcdhb9 A T 18: 37,401,406 Y151F probably benign Het
Pcnx2 C T 8: 125,761,523 probably null Het
Plekhg4 T C 8: 105,380,750 F892S probably damaging Het
Prmt3 T A 7: 49,780,334 F62I probably damaging Het
Ralgapa1 T C 12: 55,612,738 Y1999C probably damaging Het
Rims2 A T 15: 39,345,413 Q204L possibly damaging Het
Slc6a16 T G 7: 45,261,108 H352Q probably benign Het
Snx9 T A 17: 5,891,809 C70* probably null Het
Srprb A G 9: 103,197,601 I114T probably damaging Het
Tas2r119 A T 15: 32,177,968 I227F probably damaging Het
Tg A T 15: 66,838,057 Y163F probably benign Het
Tm2d2 A G 8: 25,022,768 T211A probably damaging Het
Tmem132b A G 5: 125,622,646 S83G probably benign Het
Trav9-4 T C 14: 53,676,429 S47P probably benign Het
Vmn2r8 T A 5: 108,802,459 H174L probably damaging Het
Xrcc1 A G 7: 24,559,845 D85G possibly damaging Het
Zfp106 C G 2: 120,531,957 A34P probably damaging Het
Zfp608 A T 18: 54,898,272 N865K probably damaging Het
Zscan5b A G 7: 6,230,519 D114G probably benign Het
Other mutations in Il10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Il10 APN 1 131021414 missense probably benign 0.00
IGL01664:Il10 APN 1 131021477 missense possibly damaging 0.95
R0139:Il10 UTSW 1 131022534 missense probably damaging 0.98
R1244:Il10 UTSW 1 131024216 missense probably damaging 0.99
R1471:Il10 UTSW 1 131021373 nonsense probably null
R2034:Il10 UTSW 1 131024185 missense probably benign
R2063:Il10 UTSW 1 131020033 missense probably damaging 1.00
R7650:Il10 UTSW 1 131021455 missense probably benign 0.13
R7840:Il10 UTSW 1 131020068 missense probably benign
R8280:Il10 UTSW 1 131020012 missense possibly damaging 0.91
Z1177:Il10 UTSW 1 131021395 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGCAGACGGACAAATCTTTG -3'
(R):5'- ATAGTTCACAGAGAAGCTCAGTG -3'

Sequencing Primer
(F):5'- ACGGACAAATCTTTGGGTCC -3'
(R):5'- AGAGGTACAAACGAGGTTTTCC -3'
Posted On2016-11-08