Incidental Mutation 'R5624:Olfr1339'
ID441724
Institutional Source Beutler Lab
Gene Symbol Olfr1339
Ensembl Gene ENSMUSG00000070820
Gene Nameolfactory receptor 1339
SynonymsGA_x6K02T2QD9B-18815145-18814198, MOR258-2
MMRRC Submission 043163-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5624 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location118732175-118736906 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118735371 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 281 (Y281N)
Ref Sequence ENSEMBL: ENSMUSP00000148988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094832] [ENSMUST00000217522]
Predicted Effect probably damaging
Transcript: ENSMUST00000094832
AA Change: Y281N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092428
Gene: ENSMUSG00000070820
AA Change: Y281N

DomainStartEndE-ValueType
Pfam:7tm_4 34 309 2.7e-53 PFAM
Pfam:7TM_GPCR_Srsx 38 307 4.1e-7 PFAM
Pfam:7tm_1 44 293 3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217522
AA Change: Y281N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T A 8: 119,615,105 probably null Het
Aoah A T 13: 20,995,479 N372I probably damaging Het
Ash1l T A 3: 88,985,609 D1598E probably damaging Het
Bcas2 T C 3: 103,173,261 C72R probably benign Het
Car9 T A 4: 43,509,146 F238Y probably benign Het
Ccnd1 T C 7: 144,938,012 S97G probably benign Het
Cfap52 C G 11: 67,927,358 C509S possibly damaging Het
Clcn4 C A 7: 7,288,944 V623L probably benign Het
Dnajc11 T C 4: 151,979,510 V483A probably benign Het
E2f8 G T 7: 48,877,961 D144E probably damaging Het
Epb41l1 G A 2: 156,533,771 probably benign Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam208b A G 13: 3,584,996 S604P possibly damaging Het
Fhit A G 14: 10,421,534 S85P probably damaging Het
Fzd8 G A 18: 9,213,268 G117S unknown Het
Gsdmc4 A G 15: 63,892,654 M379T possibly damaging Het
Hemk1 T C 9: 107,331,528 R157G probably benign Het
Il10 A G 1: 131,024,203 M158V probably benign Het
Jmjd1c G A 10: 67,233,414 M1656I probably damaging Het
Kit A T 5: 75,609,394 K155N probably benign Het
Lmtk3 C A 7: 45,786,862 A114E probably damaging Het
Lztr1 A G 16: 17,512,129 probably benign Het
Mras A G 9: 99,411,485 F34S probably damaging Het
Myo1c A G 11: 75,662,635 T516A probably damaging Het
Nme8 A C 13: 19,677,868 V197G possibly damaging Het
Olfr1089 T C 2: 86,732,805 D269G probably benign Het
Pcdhb9 A T 18: 37,401,406 Y151F probably benign Het
Pcnx2 C T 8: 125,761,523 probably null Het
Plekhg4 T C 8: 105,380,750 F892S probably damaging Het
Prmt3 T A 7: 49,780,334 F62I probably damaging Het
Ralgapa1 T C 12: 55,612,738 Y1999C probably damaging Het
Rims2 A T 15: 39,345,413 Q204L possibly damaging Het
Slc6a16 T G 7: 45,261,108 H352Q probably benign Het
Snx9 T A 17: 5,891,809 C70* probably null Het
Srprb A G 9: 103,197,601 I114T probably damaging Het
Tas2r119 A T 15: 32,177,968 I227F probably damaging Het
Tg A T 15: 66,838,057 Y163F probably benign Het
Tm2d2 A G 8: 25,022,768 T211A probably damaging Het
Tmem132b A G 5: 125,622,646 S83G probably benign Het
Trav9-4 T C 14: 53,676,429 S47P probably benign Het
Vmn2r8 T A 5: 108,802,459 H174L probably damaging Het
Xrcc1 A G 7: 24,559,845 D85G possibly damaging Het
Zfp106 C G 2: 120,531,957 A34P probably damaging Het
Zfp608 A T 18: 54,898,272 N865K probably damaging Het
Zscan5b A G 7: 6,230,519 D114G probably benign Het
Other mutations in Olfr1339
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02834:Olfr1339 APN 4 118734606 missense probably benign 0.01
R0433:Olfr1339 UTSW 4 118735090 missense probably benign 0.20
R0600:Olfr1339 UTSW 4 118734789 missense probably damaging 0.99
R0737:Olfr1339 UTSW 4 118735224 missense probably benign 0.01
R1167:Olfr1339 UTSW 4 118734632 missense possibly damaging 0.83
R1655:Olfr1339 UTSW 4 118734999 missense probably benign 0.18
R2152:Olfr1339 UTSW 4 118735249 missense possibly damaging 0.90
R3883:Olfr1339 UTSW 4 118734685 missense probably benign 0.38
R4715:Olfr1339 UTSW 4 118734655 missense probably damaging 1.00
R4750:Olfr1339 UTSW 4 118734733 missense possibly damaging 0.66
R4887:Olfr1339 UTSW 4 118734688 missense probably benign 0.20
R4888:Olfr1339 UTSW 4 118734688 missense probably benign 0.20
R7268:Olfr1339 UTSW 4 118735408 missense probably damaging 1.00
R7783:Olfr1339 UTSW 4 118734902 missense probably damaging 1.00
R7796:Olfr1339 UTSW 4 118734685 missense probably damaging 0.97
Z1177:Olfr1339 UTSW 4 118735456 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCACCATTCTGAGAATCC -3'
(R):5'- GCGAGCCATGTCCTTTAACC -3'

Sequencing Primer
(F):5'- TGAGAATCCGCTCAGCCC -3'
(R):5'- AACCCTCAGTGAATGGTTCTTG -3'
Posted On2016-11-08