Incidental Mutation 'R5624:Vmn2r8'
ID441727
Institutional Source Beutler Lab
Gene Symbol Vmn2r8
Ensembl Gene ENSMUSG00000090961
Gene Namevomeronasal 2, receptor 8
SynonymsEG627479
MMRRC Submission 043163-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R5624 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location108797193-108808754 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108802459 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 174 (H174L)
Ref Sequence ENSEMBL: ENSMUSP00000126953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172140]
Predicted Effect probably damaging
Transcript: ENSMUST00000172140
AA Change: H174L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126953
Gene: ENSMUSG00000090961
AA Change: H174L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 419 1.1e-28 PFAM
Pfam:NCD3G 507 561 8.2e-18 PFAM
Pfam:7tm_3 594 829 1.1e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T A 8: 119,615,105 probably null Het
Aoah A T 13: 20,995,479 N372I probably damaging Het
Ash1l T A 3: 88,985,609 D1598E probably damaging Het
Bcas2 T C 3: 103,173,261 C72R probably benign Het
Car9 T A 4: 43,509,146 F238Y probably benign Het
Ccnd1 T C 7: 144,938,012 S97G probably benign Het
Cfap52 C G 11: 67,927,358 C509S possibly damaging Het
Clcn4 C A 7: 7,288,944 V623L probably benign Het
Dnajc11 T C 4: 151,979,510 V483A probably benign Het
E2f8 G T 7: 48,877,961 D144E probably damaging Het
Epb41l1 G A 2: 156,533,771 probably benign Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam208b A G 13: 3,584,996 S604P possibly damaging Het
Fhit A G 14: 10,421,534 S85P probably damaging Het
Fzd8 G A 18: 9,213,268 G117S unknown Het
Gsdmc4 A G 15: 63,892,654 M379T possibly damaging Het
Hemk1 T C 9: 107,331,528 R157G probably benign Het
Il10 A G 1: 131,024,203 M158V probably benign Het
Jmjd1c G A 10: 67,233,414 M1656I probably damaging Het
Kit A T 5: 75,609,394 K155N probably benign Het
Lmtk3 C A 7: 45,786,862 A114E probably damaging Het
Lztr1 A G 16: 17,512,129 probably benign Het
Mras A G 9: 99,411,485 F34S probably damaging Het
Myo1c A G 11: 75,662,635 T516A probably damaging Het
Nme8 A C 13: 19,677,868 V197G possibly damaging Het
Olfr1089 T C 2: 86,732,805 D269G probably benign Het
Olfr1339 T A 4: 118,735,371 Y281N probably damaging Het
Pcdhb9 A T 18: 37,401,406 Y151F probably benign Het
Pcnx2 C T 8: 125,761,523 probably null Het
Plekhg4 T C 8: 105,380,750 F892S probably damaging Het
Prmt3 T A 7: 49,780,334 F62I probably damaging Het
Ralgapa1 T C 12: 55,612,738 Y1999C probably damaging Het
Rims2 A T 15: 39,345,413 Q204L possibly damaging Het
Slc6a16 T G 7: 45,261,108 H352Q probably benign Het
Snx9 T A 17: 5,891,809 C70* probably null Het
Srprb A G 9: 103,197,601 I114T probably damaging Het
Tas2r119 A T 15: 32,177,968 I227F probably damaging Het
Tg A T 15: 66,838,057 Y163F probably benign Het
Tm2d2 A G 8: 25,022,768 T211A probably damaging Het
Tmem132b A G 5: 125,622,646 S83G probably benign Het
Trav9-4 T C 14: 53,676,429 S47P probably benign Het
Xrcc1 A G 7: 24,559,845 D85G possibly damaging Het
Zfp106 C G 2: 120,531,957 A34P probably damaging Het
Zfp608 A T 18: 54,898,272 N865K probably damaging Het
Zscan5b A G 7: 6,230,519 D114G probably benign Het
Other mutations in Vmn2r8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02957:Vmn2r8 APN 5 108802225 missense probably benign 0.01
R0324:Vmn2r8 UTSW 5 108797941 unclassified probably null
R0335:Vmn2r8 UTSW 5 108797451 unclassified probably null
R0394:Vmn2r8 UTSW 5 108802072 missense probably benign 0.12
R0501:Vmn2r8 UTSW 5 108803183 missense probably benign 0.03
R0615:Vmn2r8 UTSW 5 108799329 missense probably damaging 1.00
R0678:Vmn2r8 UTSW 5 108800546 missense probably benign 0.00
R1167:Vmn2r8 UTSW 5 108803176 missense probably benign 0.01
R1187:Vmn2r8 UTSW 5 108803219 nonsense probably null
R1406:Vmn2r8 UTSW 5 108802368 missense probably benign
R1406:Vmn2r8 UTSW 5 108802368 missense probably benign
R1451:Vmn2r8 UTSW 5 108798067 missense probably damaging 1.00
R1535:Vmn2r8 UTSW 5 108802174 missense probably damaging 1.00
R1795:Vmn2r8 UTSW 5 108803106 missense probably benign
R1874:Vmn2r8 UTSW 5 108802418 missense possibly damaging 0.74
R1908:Vmn2r8 UTSW 5 108797570 missense probably benign 0.03
R1925:Vmn2r8 UTSW 5 108802153 missense probably damaging 0.97
R1960:Vmn2r8 UTSW 5 108799286 missense probably damaging 0.99
R1961:Vmn2r8 UTSW 5 108798095 missense probably benign 0.45
R1967:Vmn2r8 UTSW 5 108802383 missense probably benign 0.01
R2095:Vmn2r8 UTSW 5 108808621 missense possibly damaging 0.94
R2159:Vmn2r8 UTSW 5 108802303 missense probably benign 0.22
R4240:Vmn2r8 UTSW 5 108797503 missense probably damaging 0.99
R4581:Vmn2r8 UTSW 5 108801704 missense probably benign 0.03
R4744:Vmn2r8 UTSW 5 108808581 missense probably benign 0.00
R4755:Vmn2r8 UTSW 5 108801700 missense probably benign 0.03
R4917:Vmn2r8 UTSW 5 108797398 missense probably damaging 1.00
R4957:Vmn2r8 UTSW 5 108799263 missense probably benign 0.16
R5141:Vmn2r8 UTSW 5 108808706 missense probably damaging 0.96
R5481:Vmn2r8 UTSW 5 108801770 missense probably benign 0.09
R5571:Vmn2r8 UTSW 5 108802240 missense probably damaging 1.00
R6003:Vmn2r8 UTSW 5 108797382 missense probably damaging 1.00
R6243:Vmn2r8 UTSW 5 108799345 missense probably benign 0.01
R6265:Vmn2r8 UTSW 5 108808597 missense probably benign
R6315:Vmn2r8 UTSW 5 108801891 missense probably benign
R6413:Vmn2r8 UTSW 5 108801723 missense probably benign 0.09
R7120:Vmn2r8 UTSW 5 108808638 missense possibly damaging 0.56
R7406:Vmn2r8 UTSW 5 108800576 missense probably benign 0.00
R7409:Vmn2r8 UTSW 5 108808583 nonsense probably null
R7489:Vmn2r8 UTSW 5 108797656 missense possibly damaging 0.95
R7532:Vmn2r8 UTSW 5 108802240 missense probably benign 0.22
R7534:Vmn2r8 UTSW 5 108802174 missense possibly damaging 0.94
Z1088:Vmn2r8 UTSW 5 108801998 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTAAACAGATTCCATGTCTTTGC -3'
(R):5'- ATTCAGACTTCTCAGGGATACTCTAG -3'

Sequencing Primer
(F):5'- AACAGATTCCATGTCTTTGCATTTC -3'
(R):5'- TCAGGGATACTCTAGACTCTAATAGG -3'
Posted On2016-11-08