Incidental Mutation 'R5624:Xrcc1'
ID441731
Institutional Source Beutler Lab
Gene Symbol Xrcc1
Ensembl Gene ENSMUSG00000051768
Gene NameX-ray repair complementing defective repair in Chinese hamster cells 1
SynonymsXrcc-1
MMRRC Submission 043163-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5624 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24546289-24573440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24559845 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 85 (D85G)
Ref Sequence ENSEMBL: ENSMUSP00000146105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063249] [ENSMUST00000205573]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063249
AA Change: D85G

PolyPhen 2 Score 0.575 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000070995
Gene: ENSMUSG00000051768
AA Change: D85G

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 151 6.9e-66 PFAM
low complexity region 212 238 N/A INTRINSIC
low complexity region 278 294 N/A INTRINSIC
BRCT 317 393 8e-19 SMART
low complexity region 407 424 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
BRCT 538 617 5.5e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205561
Predicted Effect possibly damaging
Transcript: ENSMUST00000205573
AA Change: D85G

PolyPhen 2 Score 0.575 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206067
Meta Mutation Damage Score 0.2578 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the efficient repair of DNA single-strand breaks formed by exposure to ionizing radiation and alkylating agents. This protein interacts with DNA ligase III, polymerase beta and poly (ADP-ribose) polymerase to participate in the base excision repair pathway. It may play a role in DNA processing during meiogenesis and recombination in germ cells. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants accumulate unrepaired DNA strand breaks in the egg cylinder, show increased cell death in epiblast, developmental arrest at embryonic day 6.5, morphological anomalies in visceral embryonic endoderm by day 7.5 and die by day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T A 8: 119,615,105 probably null Het
Aoah A T 13: 20,995,479 N372I probably damaging Het
Ash1l T A 3: 88,985,609 D1598E probably damaging Het
Bcas2 T C 3: 103,173,261 C72R probably benign Het
Car9 T A 4: 43,509,146 F238Y probably benign Het
Ccnd1 T C 7: 144,938,012 S97G probably benign Het
Cfap52 C G 11: 67,927,358 C509S possibly damaging Het
Clcn4 C A 7: 7,288,944 V623L probably benign Het
Dnajc11 T C 4: 151,979,510 V483A probably benign Het
E2f8 G T 7: 48,877,961 D144E probably damaging Het
Epb41l1 G A 2: 156,533,771 probably benign Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam208b A G 13: 3,584,996 S604P possibly damaging Het
Fhit A G 14: 10,421,534 S85P probably damaging Het
Fzd8 G A 18: 9,213,268 G117S unknown Het
Gsdmc4 A G 15: 63,892,654 M379T possibly damaging Het
Hemk1 T C 9: 107,331,528 R157G probably benign Het
Il10 A G 1: 131,024,203 M158V probably benign Het
Jmjd1c G A 10: 67,233,414 M1656I probably damaging Het
Kit A T 5: 75,609,394 K155N probably benign Het
Lmtk3 C A 7: 45,786,862 A114E probably damaging Het
Lztr1 A G 16: 17,512,129 probably benign Het
Mras A G 9: 99,411,485 F34S probably damaging Het
Myo1c A G 11: 75,662,635 T516A probably damaging Het
Nme8 A C 13: 19,677,868 V197G possibly damaging Het
Olfr1089 T C 2: 86,732,805 D269G probably benign Het
Olfr1339 T A 4: 118,735,371 Y281N probably damaging Het
Pcdhb9 A T 18: 37,401,406 Y151F probably benign Het
Pcnx2 C T 8: 125,761,523 probably null Het
Plekhg4 T C 8: 105,380,750 F892S probably damaging Het
Prmt3 T A 7: 49,780,334 F62I probably damaging Het
Ralgapa1 T C 12: 55,612,738 Y1999C probably damaging Het
Rims2 A T 15: 39,345,413 Q204L possibly damaging Het
Slc6a16 T G 7: 45,261,108 H352Q probably benign Het
Snx9 T A 17: 5,891,809 C70* probably null Het
Srprb A G 9: 103,197,601 I114T probably damaging Het
Tas2r119 A T 15: 32,177,968 I227F probably damaging Het
Tg A T 15: 66,838,057 Y163F probably benign Het
Tm2d2 A G 8: 25,022,768 T211A probably damaging Het
Tmem132b A G 5: 125,622,646 S83G probably benign Het
Trav9-4 T C 14: 53,676,429 S47P probably benign Het
Vmn2r8 T A 5: 108,802,459 H174L probably damaging Het
Zfp106 C G 2: 120,531,957 A34P probably damaging Het
Zfp608 A T 18: 54,898,272 N865K probably damaging Het
Zscan5b A G 7: 6,230,519 D114G probably benign Het
Other mutations in Xrcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Xrcc1 APN 7 24547884 critical splice donor site probably null
IGL01830:Xrcc1 APN 7 24573342 utr 3 prime probably benign
IGL02349:Xrcc1 APN 7 24567042 nonsense probably null
IGL02433:Xrcc1 APN 7 24565554 missense possibly damaging 0.96
IGL03131:Xrcc1 APN 7 24573294 nonsense probably null
Bilberry UTSW 7 24570218 missense probably damaging 1.00
R0090:Xrcc1 UTSW 7 24570217 missense probably damaging 0.99
R0517:Xrcc1 UTSW 7 24570319 splice site probably benign
R0612:Xrcc1 UTSW 7 24570319 splice site probably benign
R1234:Xrcc1 UTSW 7 24567845 missense possibly damaging 0.71
R1577:Xrcc1 UTSW 7 24565627 nonsense probably null
R1796:Xrcc1 UTSW 7 24547827 missense probably damaging 1.00
R1863:Xrcc1 UTSW 7 24570575 missense possibly damaging 0.65
R3788:Xrcc1 UTSW 7 24566908 missense probably benign 0.08
R3794:Xrcc1 UTSW 7 24570560 missense probably benign 0.05
R4806:Xrcc1 UTSW 7 24570480 missense probably benign 0.14
R5206:Xrcc1 UTSW 7 24567563 missense probably damaging 1.00
R5414:Xrcc1 UTSW 7 24570218 missense probably damaging 1.00
R5532:Xrcc1 UTSW 7 24567928 critical splice donor site probably null
R5990:Xrcc1 UTSW 7 24567868 missense probably damaging 1.00
R6603:Xrcc1 UTSW 7 24571034 nonsense probably null
R6669:Xrcc1 UTSW 7 24547337 missense probably damaging 1.00
R6716:Xrcc1 UTSW 7 24567146 critical splice donor site probably null
R6881:Xrcc1 UTSW 7 24547351 nonsense probably null
R7227:Xrcc1 UTSW 7 24547332 missense probably damaging 1.00
R8204:Xrcc1 UTSW 7 24572284 missense possibly damaging 0.88
R8284:Xrcc1 UTSW 7 24572278 missense probably damaging 1.00
R8285:Xrcc1 UTSW 7 24572278 missense probably damaging 1.00
R8287:Xrcc1 UTSW 7 24572278 missense probably damaging 1.00
X0019:Xrcc1 UTSW 7 24573128 missense probably damaging 1.00
X0024:Xrcc1 UTSW 7 24573079 missense probably damaging 1.00
Z1176:Xrcc1 UTSW 7 24547839 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGCCTGCTAGAAACAGATCACTC -3'
(R):5'- AATGTAATCACATGTGGCGGC -3'

Sequencing Primer
(F):5'- TGCTAGAAACAGATCACTCTACTC -3'
(R):5'- CACATGTGGCGGCTGGTG -3'
Posted On2016-11-08