Incidental Mutation 'R5624:Lmtk3'
ID441733
Institutional Source Beutler Lab
Gene Symbol Lmtk3
Ensembl Gene ENSMUSG00000062044
Gene Namelemur tyrosine kinase 3
SynonymsAATYK3, Aatyk3
MMRRC Submission 043163-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.509) question?
Stock #R5624 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45783738-45804144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45786862 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 114 (A114E)
Ref Sequence ENSEMBL: ENSMUSP00000148041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072580] [ENSMUST00000120005] [ENSMUST00000209617] [ENSMUST00000209701] [ENSMUST00000209739] [ENSMUST00000211609]
Predicted Effect probably damaging
Transcript: ENSMUST00000072580
AA Change: A88E

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072388
Gene: ENSMUSG00000062044
AA Change: A88E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Pfam:Pkinase 133 408 8.3e-37 PFAM
Pfam:Pkinase_Tyr 133 408 4.9e-64 PFAM
low complexity region 415 444 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
low complexity region 639 669 N/A INTRINSIC
low complexity region 735 791 N/A INTRINSIC
low complexity region 797 843 N/A INTRINSIC
low complexity region 1081 1105 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
low complexity region 1196 1223 N/A INTRINSIC
low complexity region 1225 1263 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
low complexity region 1384 1393 N/A INTRINSIC
low complexity region 1407 1421 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118564
AA Change: A114E

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113323
Gene: ENSMUSG00000062044
AA Change: A114E

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
transmembrane domain 61 83 N/A INTRINSIC
Pfam:Pkinase_Tyr 159 434 4.2e-64 PFAM
Pfam:Pkinase 159 436 1.3e-33 PFAM
low complexity region 441 470 N/A INTRINSIC
low complexity region 510 532 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
low complexity region 665 695 N/A INTRINSIC
low complexity region 761 817 N/A INTRINSIC
low complexity region 823 869 N/A INTRINSIC
low complexity region 1107 1131 N/A INTRINSIC
low complexity region 1142 1158 N/A INTRINSIC
low complexity region 1222 1249 N/A INTRINSIC
low complexity region 1251 1289 N/A INTRINSIC
low complexity region 1371 1388 N/A INTRINSIC
low complexity region 1410 1419 N/A INTRINSIC
low complexity region 1433 1447 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120005
AA Change: A88E

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112592
Gene: ENSMUSG00000062044
AA Change: A88E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Pfam:Pkinase 133 408 8.3e-37 PFAM
Pfam:Pkinase_Tyr 133 408 4.9e-64 PFAM
low complexity region 415 444 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
low complexity region 639 669 N/A INTRINSIC
low complexity region 735 791 N/A INTRINSIC
low complexity region 797 843 N/A INTRINSIC
low complexity region 1081 1105 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
low complexity region 1196 1223 N/A INTRINSIC
low complexity region 1225 1263 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
low complexity region 1384 1393 N/A INTRINSIC
low complexity region 1407 1421 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123585
AA Change: A88E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121551
Gene: ENSMUSG00000062044
AA Change: A88E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133428
AA Change: A88E

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122932
Gene: ENSMUSG00000062044
AA Change: A88E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Pfam:Pkinase 133 203 2.3e-6 PFAM
Pfam:Pkinase_Tyr 133 203 4.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134347
AA Change: A195E
Predicted Effect not run
Transcript: ENSMUST00000143894
AA Change: A27E
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000209617
AA Change: A114E

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000209701
AA Change: A88E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000209739
Predicted Effect probably damaging
Transcript: ENSMUST00000211609
AA Change: A88E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210021
Predicted Effect probably benign
Transcript: ENSMUST00000211127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211779
Meta Mutation Damage Score 0.1126 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit pronounced behavioral abnormalities, including locomotor hyperactivity, reduced anxiety, and decreased depression-like behavior, an increased striatal dopamine turnover rate, and enhanced behavioral response to methylphenidate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T A 8: 119,615,105 probably null Het
Aoah A T 13: 20,995,479 N372I probably damaging Het
Ash1l T A 3: 88,985,609 D1598E probably damaging Het
Bcas2 T C 3: 103,173,261 C72R probably benign Het
Car9 T A 4: 43,509,146 F238Y probably benign Het
Ccnd1 T C 7: 144,938,012 S97G probably benign Het
Cfap52 C G 11: 67,927,358 C509S possibly damaging Het
Clcn4 C A 7: 7,288,944 V623L probably benign Het
Dnajc11 T C 4: 151,979,510 V483A probably benign Het
E2f8 G T 7: 48,877,961 D144E probably damaging Het
Epb41l1 G A 2: 156,533,771 probably benign Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam208b A G 13: 3,584,996 S604P possibly damaging Het
Fhit A G 14: 10,421,534 S85P probably damaging Het
Fzd8 G A 18: 9,213,268 G117S unknown Het
Gsdmc4 A G 15: 63,892,654 M379T possibly damaging Het
Hemk1 T C 9: 107,331,528 R157G probably benign Het
Il10 A G 1: 131,024,203 M158V probably benign Het
Jmjd1c G A 10: 67,233,414 M1656I probably damaging Het
Kit A T 5: 75,609,394 K155N probably benign Het
Lztr1 A G 16: 17,512,129 probably benign Het
Mras A G 9: 99,411,485 F34S probably damaging Het
Myo1c A G 11: 75,662,635 T516A probably damaging Het
Nme8 A C 13: 19,677,868 V197G possibly damaging Het
Olfr1089 T C 2: 86,732,805 D269G probably benign Het
Olfr1339 T A 4: 118,735,371 Y281N probably damaging Het
Pcdhb9 A T 18: 37,401,406 Y151F probably benign Het
Pcnx2 C T 8: 125,761,523 probably null Het
Plekhg4 T C 8: 105,380,750 F892S probably damaging Het
Prmt3 T A 7: 49,780,334 F62I probably damaging Het
Ralgapa1 T C 12: 55,612,738 Y1999C probably damaging Het
Rims2 A T 15: 39,345,413 Q204L possibly damaging Het
Slc6a16 T G 7: 45,261,108 H352Q probably benign Het
Snx9 T A 17: 5,891,809 C70* probably null Het
Srprb A G 9: 103,197,601 I114T probably damaging Het
Tas2r119 A T 15: 32,177,968 I227F probably damaging Het
Tg A T 15: 66,838,057 Y163F probably benign Het
Tm2d2 A G 8: 25,022,768 T211A probably damaging Het
Tmem132b A G 5: 125,622,646 S83G probably benign Het
Trav9-4 T C 14: 53,676,429 S47P probably benign Het
Vmn2r8 T A 5: 108,802,459 H174L probably damaging Het
Xrcc1 A G 7: 24,559,845 D85G possibly damaging Het
Zfp106 C G 2: 120,531,957 A34P probably damaging Het
Zfp608 A T 18: 54,898,272 N865K probably damaging Het
Zscan5b A G 7: 6,230,519 D114G probably benign Het
Other mutations in Lmtk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Lmtk3 APN 7 45790907 missense probably damaging 1.00
IGL01996:Lmtk3 APN 7 45793447 splice site probably null
IGL02146:Lmtk3 APN 7 45794947 unclassified probably benign
IGL02192:Lmtk3 APN 7 45794509 unclassified probably benign
IGL02598:Lmtk3 APN 7 45793140 missense probably damaging 1.00
BB006:Lmtk3 UTSW 7 45795148 missense unknown
BB016:Lmtk3 UTSW 7 45795148 missense unknown
R0469:Lmtk3 UTSW 7 45794112 missense possibly damaging 0.95
R0510:Lmtk3 UTSW 7 45794112 missense possibly damaging 0.95
R0603:Lmtk3 UTSW 7 45795556 unclassified probably benign
R0781:Lmtk3 UTSW 7 45795003 unclassified probably benign
R1110:Lmtk3 UTSW 7 45795003 unclassified probably benign
R1270:Lmtk3 UTSW 7 45793828 missense probably damaging 0.96
R1535:Lmtk3 UTSW 7 45794570 unclassified probably benign
R1666:Lmtk3 UTSW 7 45794164 missense probably benign 0.03
R1807:Lmtk3 UTSW 7 45793278 missense probably benign 0.02
R1883:Lmtk3 UTSW 7 45786849 missense probably damaging 1.00
R2060:Lmtk3 UTSW 7 45800911 critical splice acceptor site probably null
R2107:Lmtk3 UTSW 7 45793969 missense possibly damaging 0.56
R2214:Lmtk3 UTSW 7 45794853 unclassified probably benign
R2369:Lmtk3 UTSW 7 45795088 unclassified probably benign
R4084:Lmtk3 UTSW 7 45793292 missense probably damaging 0.97
R4246:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4247:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4249:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4250:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4587:Lmtk3 UTSW 7 45794080 missense possibly damaging 0.92
R5026:Lmtk3 UTSW 7 45794412 unclassified probably benign
R5275:Lmtk3 UTSW 7 45791298 missense probably damaging 1.00
R5295:Lmtk3 UTSW 7 45791298 missense probably damaging 1.00
R5688:Lmtk3 UTSW 7 45791410 missense probably damaging 1.00
R6478:Lmtk3 UTSW 7 45798589 missense unknown
R6737:Lmtk3 UTSW 7 45793627 missense probably damaging 0.99
R6800:Lmtk3 UTSW 7 45793809 missense possibly damaging 0.91
R6856:Lmtk3 UTSW 7 45794297 unclassified probably benign
R7319:Lmtk3 UTSW 7 45794316 missense unknown
R7335:Lmtk3 UTSW 7 45795157 missense unknown
R7353:Lmtk3 UTSW 7 45788000 missense possibly damaging 0.46
R7621:Lmtk3 UTSW 7 45793417 missense probably damaging 1.00
R7699:Lmtk3 UTSW 7 45792574 missense probably damaging 1.00
R7700:Lmtk3 UTSW 7 45792574 missense probably damaging 1.00
R7836:Lmtk3 UTSW 7 45786903 missense possibly damaging 0.89
R7929:Lmtk3 UTSW 7 45795148 missense unknown
R7951:Lmtk3 UTSW 7 45785606 missense probably benign 0.01
R7976:Lmtk3 UTSW 7 45795466 missense unknown
R8128:Lmtk3 UTSW 7 45794174 missense
X0052:Lmtk3 UTSW 7 45793498 missense probably benign 0.03
X0067:Lmtk3 UTSW 7 45794680 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTTGGGATGCGCACACTAGC -3'
(R):5'- TTACTTCCACGAATCTAGGGCTC -3'

Sequencing Primer
(F):5'- CACACTAGCGGAAATTGGGCTG -3'
(R):5'- ACGAATCTAGGGCTCTGCATTCTG -3'
Posted On2016-11-08