Incidental Mutation 'R5624:E2f8'
ID441734
Institutional Source Beutler Lab
Gene Symbol E2f8
Ensembl Gene ENSMUSG00000046179
Gene NameE2F transcription factor 8
Synonyms4432406C08Rik
MMRRC Submission 043163-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5624 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location48866429-48881596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 48877961 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 144 (D144E)
Ref Sequence ENSEMBL: ENSMUSP00000112883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058745] [ENSMUST00000119223]
Predicted Effect probably damaging
Transcript: ENSMUST00000058745
AA Change: D144E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056778
Gene: ENSMUSG00000046179
AA Change: D144E

DomainStartEndE-ValueType
E2F_TDP 113 182 4.25e-29 SMART
E2F_TDP 261 347 2.26e-33 SMART
low complexity region 819 832 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119223
AA Change: D144E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112883
Gene: ENSMUSG00000046179
AA Change: D144E

DomainStartEndE-ValueType
Pfam:E2F_TDP 113 182 8.9e-24 PFAM
Pfam:E2F_TDP 261 347 3e-21 PFAM
low complexity region 819 832 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210463
Meta Mutation Damage Score 0.2130 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transcription factors which regulate the expression of genes required for progression through the cell cycle. The encoded protein regulates progression from G1 to S phase by ensuring the nucleus divides at the proper time. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele develop normally through puberty and live to old age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T A 8: 119,615,105 probably null Het
Aoah A T 13: 20,995,479 N372I probably damaging Het
Ash1l T A 3: 88,985,609 D1598E probably damaging Het
Bcas2 T C 3: 103,173,261 C72R probably benign Het
Car9 T A 4: 43,509,146 F238Y probably benign Het
Ccnd1 T C 7: 144,938,012 S97G probably benign Het
Cfap52 C G 11: 67,927,358 C509S possibly damaging Het
Clcn4 C A 7: 7,288,944 V623L probably benign Het
Dnajc11 T C 4: 151,979,510 V483A probably benign Het
Epb41l1 G A 2: 156,533,771 probably benign Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam208b A G 13: 3,584,996 S604P possibly damaging Het
Fhit A G 14: 10,421,534 S85P probably damaging Het
Fzd8 G A 18: 9,213,268 G117S unknown Het
Gsdmc4 A G 15: 63,892,654 M379T possibly damaging Het
Hemk1 T C 9: 107,331,528 R157G probably benign Het
Il10 A G 1: 131,024,203 M158V probably benign Het
Jmjd1c G A 10: 67,233,414 M1656I probably damaging Het
Kit A T 5: 75,609,394 K155N probably benign Het
Lmtk3 C A 7: 45,786,862 A114E probably damaging Het
Lztr1 A G 16: 17,512,129 probably benign Het
Mras A G 9: 99,411,485 F34S probably damaging Het
Myo1c A G 11: 75,662,635 T516A probably damaging Het
Nme8 A C 13: 19,677,868 V197G possibly damaging Het
Olfr1089 T C 2: 86,732,805 D269G probably benign Het
Olfr1339 T A 4: 118,735,371 Y281N probably damaging Het
Pcdhb9 A T 18: 37,401,406 Y151F probably benign Het
Pcnx2 C T 8: 125,761,523 probably null Het
Plekhg4 T C 8: 105,380,750 F892S probably damaging Het
Prmt3 T A 7: 49,780,334 F62I probably damaging Het
Ralgapa1 T C 12: 55,612,738 Y1999C probably damaging Het
Rims2 A T 15: 39,345,413 Q204L possibly damaging Het
Slc6a16 T G 7: 45,261,108 H352Q probably benign Het
Snx9 T A 17: 5,891,809 C70* probably null Het
Srprb A G 9: 103,197,601 I114T probably damaging Het
Tas2r119 A T 15: 32,177,968 I227F probably damaging Het
Tg A T 15: 66,838,057 Y163F probably benign Het
Tm2d2 A G 8: 25,022,768 T211A probably damaging Het
Tmem132b A G 5: 125,622,646 S83G probably benign Het
Trav9-4 T C 14: 53,676,429 S47P probably benign Het
Vmn2r8 T A 5: 108,802,459 H174L probably damaging Het
Xrcc1 A G 7: 24,559,845 D85G possibly damaging Het
Zfp106 C G 2: 120,531,957 A34P probably damaging Het
Zfp608 A T 18: 54,898,272 N865K probably damaging Het
Zscan5b A G 7: 6,230,519 D114G probably benign Het
Other mutations in E2f8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:E2f8 APN 7 48868203 missense probably damaging 1.00
IGL01121:E2f8 APN 7 48867821 nonsense probably null
IGL01351:E2f8 APN 7 48867151 missense probably benign 0.00
IGL01592:E2f8 APN 7 48867857 missense probably damaging 1.00
IGL01730:E2f8 APN 7 48877934 splice site probably benign
IGL02708:E2f8 APN 7 48867234 splice site probably null
R0535:E2f8 UTSW 7 48871810 splice site probably benign
R1356:E2f8 UTSW 7 48880270 splice site probably benign
R1902:E2f8 UTSW 7 48871172 missense probably benign 0.32
R1989:E2f8 UTSW 7 48873280 missense probably benign 0.30
R2109:E2f8 UTSW 7 48875107 missense probably damaging 1.00
R4126:E2f8 UTSW 7 48875607 missense probably damaging 0.99
R4384:E2f8 UTSW 7 48867099 missense possibly damaging 0.93
R4817:E2f8 UTSW 7 48867746 missense probably benign
R4939:E2f8 UTSW 7 48872138 missense probably benign 0.02
R4979:E2f8 UTSW 7 48875170 intron probably benign
R5274:E2f8 UTSW 7 48867177 missense probably damaging 0.97
R5677:E2f8 UTSW 7 48867195 missense probably damaging 0.99
R5940:E2f8 UTSW 7 48871077 missense probably benign 0.03
R5988:E2f8 UTSW 7 48874995 missense probably damaging 1.00
R6003:E2f8 UTSW 7 48870777 missense probably benign
R6107:E2f8 UTSW 7 48867676 missense probably benign 0.01
R6816:E2f8 UTSW 7 48875583 missense possibly damaging 0.46
R7329:E2f8 UTSW 7 48872110 missense probably damaging 1.00
R7343:E2f8 UTSW 7 48867965 missense probably damaging 0.97
R7444:E2f8 UTSW 7 48868179 missense probably damaging 0.98
R7474:E2f8 UTSW 7 48875760 missense probably damaging 1.00
R7793:E2f8 UTSW 7 48878075 missense probably benign 0.00
Z1177:E2f8 UTSW 7 48875546 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCCAAGACCGAGTTATGCTC -3'
(R):5'- AGTCATCTAGCACAGAGGCC -3'

Sequencing Primer
(F):5'- CTCAAATTAACAGGACTTGTGAGGC -3'
(R):5'- GTCATGCTCTATTCCAGAATGAGAC -3'
Posted On2016-11-08