Incidental Mutation 'R5624:Adad2'
ID441739
Institutional Source Beutler Lab
Gene Symbol Adad2
Ensembl Gene ENSMUSG00000024266
Gene Nameadenosine deaminase domain containing 2
Synonyms
MMRRC Submission 043163-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5624 (G1)
Quality Score124
Status Validated
Chromosome8
Chromosomal Location119612747-119616924 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 119615105 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098361] [ENSMUST00000098361]
Predicted Effect probably null
Transcript: ENSMUST00000098361
SMART Domains Protein: ENSMUSP00000095964
Gene: ENSMUSG00000024266

DomainStartEndE-ValueType
DSRM 94 158 4e-7 SMART
ADEAMc 185 560 2.7e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000098361
SMART Domains Protein: ENSMUSP00000095964
Gene: ENSMUSG00000024266

DomainStartEndE-ValueType
DSRM 94 158 4e-7 SMART
ADEAMc 185 560 2.7e-37 SMART
Meta Mutation Damage Score 0.3456 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoah A T 13: 20,995,479 N372I probably damaging Het
Ash1l T A 3: 88,985,609 D1598E probably damaging Het
Bcas2 T C 3: 103,173,261 C72R probably benign Het
Car9 T A 4: 43,509,146 F238Y probably benign Het
Ccnd1 T C 7: 144,938,012 S97G probably benign Het
Cfap52 C G 11: 67,927,358 C509S possibly damaging Het
Clcn4 C A 7: 7,288,944 V623L probably benign Het
Dnajc11 T C 4: 151,979,510 V483A probably benign Het
E2f8 G T 7: 48,877,961 D144E probably damaging Het
Epb41l1 G A 2: 156,533,771 probably benign Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam208b A G 13: 3,584,996 S604P possibly damaging Het
Fhit A G 14: 10,421,534 S85P probably damaging Het
Fzd8 G A 18: 9,213,268 G117S unknown Het
Gsdmc4 A G 15: 63,892,654 M379T possibly damaging Het
Hemk1 T C 9: 107,331,528 R157G probably benign Het
Il10 A G 1: 131,024,203 M158V probably benign Het
Jmjd1c G A 10: 67,233,414 M1656I probably damaging Het
Kit A T 5: 75,609,394 K155N probably benign Het
Lmtk3 C A 7: 45,786,862 A114E probably damaging Het
Lztr1 A G 16: 17,512,129 probably benign Het
Mras A G 9: 99,411,485 F34S probably damaging Het
Myo1c A G 11: 75,662,635 T516A probably damaging Het
Nme8 A C 13: 19,677,868 V197G possibly damaging Het
Olfr1089 T C 2: 86,732,805 D269G probably benign Het
Olfr1339 T A 4: 118,735,371 Y281N probably damaging Het
Pcdhb9 A T 18: 37,401,406 Y151F probably benign Het
Pcnx2 C T 8: 125,761,523 probably null Het
Plekhg4 T C 8: 105,380,750 F892S probably damaging Het
Prmt3 T A 7: 49,780,334 F62I probably damaging Het
Ralgapa1 T C 12: 55,612,738 Y1999C probably damaging Het
Rims2 A T 15: 39,345,413 Q204L possibly damaging Het
Slc6a16 T G 7: 45,261,108 H352Q probably benign Het
Snx9 T A 17: 5,891,809 C70* probably null Het
Srprb A G 9: 103,197,601 I114T probably damaging Het
Tas2r119 A T 15: 32,177,968 I227F probably damaging Het
Tg A T 15: 66,838,057 Y163F probably benign Het
Tm2d2 A G 8: 25,022,768 T211A probably damaging Het
Tmem132b A G 5: 125,622,646 S83G probably benign Het
Trav9-4 T C 14: 53,676,429 S47P probably benign Het
Vmn2r8 T A 5: 108,802,459 H174L probably damaging Het
Xrcc1 A G 7: 24,559,845 D85G possibly damaging Het
Zfp106 C G 2: 120,531,957 A34P probably damaging Het
Zfp608 A T 18: 54,898,272 N865K probably damaging Het
Zscan5b A G 7: 6,230,519 D114G probably benign Het
Other mutations in Adad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Adad2 APN 8 119616669 missense probably damaging 1.00
IGL02385:Adad2 APN 8 119615034 splice site probably benign
R0619:Adad2 UTSW 8 119613000 missense probably benign 0.01
R3410:Adad2 UTSW 8 119615969 missense probably benign
R4961:Adad2 UTSW 8 119615658 missense probably damaging 0.99
R5479:Adad2 UTSW 8 119614915 missense possibly damaging 0.93
R5521:Adad2 UTSW 8 119612789 missense probably benign 0.43
R5610:Adad2 UTSW 8 119614761 missense probably benign 0.00
R6237:Adad2 UTSW 8 119615763 missense probably damaging 1.00
R6566:Adad2 UTSW 8 119614232 missense probably benign 0.13
R8069:Adad2 UTSW 8 119616007 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTACAGAGACTATCCTGACCC -3'
(R):5'- TGTGTGACCAGTAGGAGCTG -3'

Sequencing Primer
(F):5'- GAGACTATCCTGACCCACGAG -3'
(R):5'- CTGCCGGAAGAAGAACCTG -3'
Posted On2016-11-08