Incidental Mutation 'R5624:Mras'
ID441742
Institutional Source Beutler Lab
Gene Symbol Mras
Ensembl Gene ENSMUSG00000032470
Gene Namemuscle and microspikes RAS
Synonyms2900078C09Rik
MMRRC Submission 043163-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R5624 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location99385420-99437381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99411485 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 34 (F34S)
Ref Sequence ENSEMBL: ENSMUSP00000121307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035045] [ENSMUST00000119472] [ENSMUST00000122384] [ENSMUST00000123771]
Predicted Effect probably damaging
Transcript: ENSMUST00000035045
AA Change: F34S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035045
Gene: ENSMUSG00000032470
AA Change: F34S

DomainStartEndE-ValueType
RAS 11 178 4.26e-114 SMART
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119472
AA Change: F34S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112407
Gene: ENSMUSG00000032470
AA Change: F34S

DomainStartEndE-ValueType
RAS 11 178 4.26e-114 SMART
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122384
AA Change: F34S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113275
Gene: ENSMUSG00000032470
AA Change: F34S

DomainStartEndE-ValueType
RAS 11 178 4.26e-114 SMART
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123771
AA Change: F34S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121307
Gene: ENSMUSG00000032470
AA Change: F34S

DomainStartEndE-ValueType
RAS 11 130 1.06e-68 SMART
Meta Mutation Damage Score 0.4353 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras family of small GTPases. These membrane-associated proteins function as signal transducers in multiple processes including cell growth and differentiation, and dysregulation of Ras signaling has been associated with many types of cancer. The encoded protein may play a role in the tumor necrosis factor-alpha and MAP kinase signaling pathways. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene exhibit a decreased mean percentage of peripheral blood B cells but no other evidence of morphological or neurological defects; mutant astrocytes display normal responsiveness to different trophic factors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T A 8: 119,615,105 probably null Het
Aoah A T 13: 20,995,479 N372I probably damaging Het
Ash1l T A 3: 88,985,609 D1598E probably damaging Het
Bcas2 T C 3: 103,173,261 C72R probably benign Het
Car9 T A 4: 43,509,146 F238Y probably benign Het
Ccnd1 T C 7: 144,938,012 S97G probably benign Het
Cfap52 C G 11: 67,927,358 C509S possibly damaging Het
Clcn4 C A 7: 7,288,944 V623L probably benign Het
Dnajc11 T C 4: 151,979,510 V483A probably benign Het
E2f8 G T 7: 48,877,961 D144E probably damaging Het
Epb41l1 G A 2: 156,533,771 probably benign Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam208b A G 13: 3,584,996 S604P possibly damaging Het
Fhit A G 14: 10,421,534 S85P probably damaging Het
Fzd8 G A 18: 9,213,268 G117S unknown Het
Gsdmc4 A G 15: 63,892,654 M379T possibly damaging Het
Hemk1 T C 9: 107,331,528 R157G probably benign Het
Il10 A G 1: 131,024,203 M158V probably benign Het
Jmjd1c G A 10: 67,233,414 M1656I probably damaging Het
Kit A T 5: 75,609,394 K155N probably benign Het
Lmtk3 C A 7: 45,786,862 A114E probably damaging Het
Lztr1 A G 16: 17,512,129 probably benign Het
Myo1c A G 11: 75,662,635 T516A probably damaging Het
Nme8 A C 13: 19,677,868 V197G possibly damaging Het
Olfr1089 T C 2: 86,732,805 D269G probably benign Het
Olfr1339 T A 4: 118,735,371 Y281N probably damaging Het
Pcdhb9 A T 18: 37,401,406 Y151F probably benign Het
Pcnx2 C T 8: 125,761,523 probably null Het
Plekhg4 T C 8: 105,380,750 F892S probably damaging Het
Prmt3 T A 7: 49,780,334 F62I probably damaging Het
Ralgapa1 T C 12: 55,612,738 Y1999C probably damaging Het
Rims2 A T 15: 39,345,413 Q204L possibly damaging Het
Slc6a16 T G 7: 45,261,108 H352Q probably benign Het
Snx9 T A 17: 5,891,809 C70* probably null Het
Srprb A G 9: 103,197,601 I114T probably damaging Het
Tas2r119 A T 15: 32,177,968 I227F probably damaging Het
Tg A T 15: 66,838,057 Y163F probably benign Het
Tm2d2 A G 8: 25,022,768 T211A probably damaging Het
Tmem132b A G 5: 125,622,646 S83G probably benign Het
Trav9-4 T C 14: 53,676,429 S47P probably benign Het
Vmn2r8 T A 5: 108,802,459 H174L probably damaging Het
Xrcc1 A G 7: 24,559,845 D85G possibly damaging Het
Zfp106 C G 2: 120,531,957 A34P probably damaging Het
Zfp608 A T 18: 54,898,272 N865K probably damaging Het
Zscan5b A G 7: 6,230,519 D114G probably benign Het
Other mutations in Mras
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Mras APN 9 99411495 missense probably damaging 1.00
R3918:Mras UTSW 9 99411420 missense probably damaging 1.00
R3919:Mras UTSW 9 99411420 missense probably damaging 1.00
R3981:Mras UTSW 9 99411416 missense probably damaging 1.00
R4950:Mras UTSW 9 99394484 missense probably damaging 1.00
R5375:Mras UTSW 9 99394616 missense probably damaging 1.00
R5501:Mras UTSW 9 99411546 missense probably damaging 1.00
R6349:Mras UTSW 9 99394616 missense probably damaging 1.00
R6350:Mras UTSW 9 99411507 missense probably damaging 1.00
R7453:Mras UTSW 9 99389740 missense probably benign 0.01
R8351:Mras UTSW 9 99411495 missense probably damaging 1.00
R8451:Mras UTSW 9 99411495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCCTATTGCCTCATAGC -3'
(R):5'- AGAAAGCCCATGAGTATTTTCTCC -3'

Sequencing Primer
(F):5'- CCTATAATAACAGGAAACCATGTTGC -3'
(R):5'- AGCCCATGAGTATTTTCTCCTAGTTC -3'
Posted On2016-11-08