Incidental Mutation 'R5624:Srprb'
ID441743
Institutional Source Beutler Lab
Gene Symbol Srprb
Ensembl Gene ENSMUSG00000032553
Gene Namesignal recognition particle receptor, B subunit
Synonyms
MMRRC Submission 043163-MU
Accession Numbers

Genbank: NM_009275.4; Ensembl: ENSMUST00000035157

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5624 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location103188032-103202137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103197601 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 114 (I114T)
Ref Sequence ENSEMBL: ENSMUSP00000035157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035157] [ENSMUST00000166836]
PDB Structure
The Structure of the Mammalian SRP Receptor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000035157
AA Change: I114T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035157
Gene: ENSMUSG00000032553
AA Change: I114T

DomainStartEndE-ValueType
Pfam:Arf 49 221 1.1e-17 PFAM
Pfam:SRPRB 60 239 1.2e-75 PFAM
Pfam:FeoB_N 63 214 7e-7 PFAM
Pfam:MMR_HSR1 64 179 3.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163567
Predicted Effect probably damaging
Transcript: ENSMUST00000166836
AA Change: I823T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127808
Gene: ENSMUSG00000090639
AA Change: I823T

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
TR_FER 25 338 4.98e-175 SMART
TR_FER 346 672 8.64e-193 SMART
Pfam:Arf 758 928 1.5e-15 PFAM
Pfam:SRPRB 769 948 1.4e-73 PFAM
Pfam:MMR_HSR1 773 888 7.8e-8 PFAM
Meta Mutation Damage Score 0.2781 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has similarity to mouse protein which is a subunit of the signal recognition particle receptor (SR). This subunit is a transmembrane GTPase belonging to the GTPase superfamily. It anchors alpha subunit, a peripheral membrane GTPase, to the ER membrane. SR is required for the cotranslational targeting of both secretory and membrane proteins to the ER membrane. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T A 8: 119,615,105 probably null Het
Aoah A T 13: 20,995,479 N372I probably damaging Het
Ash1l T A 3: 88,985,609 D1598E probably damaging Het
Bcas2 T C 3: 103,173,261 C72R probably benign Het
Car9 T A 4: 43,509,146 F238Y probably benign Het
Ccnd1 T C 7: 144,938,012 S97G probably benign Het
Cfap52 C G 11: 67,927,358 C509S possibly damaging Het
Clcn4 C A 7: 7,288,944 V623L probably benign Het
Dnajc11 T C 4: 151,979,510 V483A probably benign Het
E2f8 G T 7: 48,877,961 D144E probably damaging Het
Epb41l1 G A 2: 156,533,771 probably benign Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam208b A G 13: 3,584,996 S604P possibly damaging Het
Fhit A G 14: 10,421,534 S85P probably damaging Het
Fzd8 G A 18: 9,213,268 G117S unknown Het
Gsdmc4 A G 15: 63,892,654 M379T possibly damaging Het
Hemk1 T C 9: 107,331,528 R157G probably benign Het
Il10 A G 1: 131,024,203 M158V probably benign Het
Jmjd1c G A 10: 67,233,414 M1656I probably damaging Het
Kit A T 5: 75,609,394 K155N probably benign Het
Lmtk3 C A 7: 45,786,862 A114E probably damaging Het
Lztr1 A G 16: 17,512,129 probably benign Het
Mras A G 9: 99,411,485 F34S probably damaging Het
Myo1c A G 11: 75,662,635 T516A probably damaging Het
Nme8 A C 13: 19,677,868 V197G possibly damaging Het
Olfr1089 T C 2: 86,732,805 D269G probably benign Het
Olfr1339 T A 4: 118,735,371 Y281N probably damaging Het
Pcdhb9 A T 18: 37,401,406 Y151F probably benign Het
Pcnx2 C T 8: 125,761,523 probably null Het
Plekhg4 T C 8: 105,380,750 F892S probably damaging Het
Prmt3 T A 7: 49,780,334 F62I probably damaging Het
Ralgapa1 T C 12: 55,612,738 Y1999C probably damaging Het
Rims2 A T 15: 39,345,413 Q204L possibly damaging Het
Slc6a16 T G 7: 45,261,108 H352Q probably benign Het
Snx9 T A 17: 5,891,809 C70* probably null Het
Tas2r119 A T 15: 32,177,968 I227F probably damaging Het
Tg A T 15: 66,838,057 Y163F probably benign Het
Tm2d2 A G 8: 25,022,768 T211A probably damaging Het
Tmem132b A G 5: 125,622,646 S83G probably benign Het
Trav9-4 T C 14: 53,676,429 S47P probably benign Het
Vmn2r8 T A 5: 108,802,459 H174L probably damaging Het
Xrcc1 A G 7: 24,559,845 D85G possibly damaging Het
Zfp106 C G 2: 120,531,957 A34P probably damaging Het
Zfp608 A T 18: 54,898,272 N865K probably damaging Het
Zscan5b A G 7: 6,230,519 D114G probably benign Het
Other mutations in Srprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0308:Srprb UTSW 9 103202005 missense possibly damaging 0.64
R0739:Srprb UTSW 9 103197595 missense probably damaging 1.00
R1434:Srprb UTSW 9 103190302 missense probably damaging 1.00
R1679:Srprb UTSW 9 103192207 splice site probably benign
R2370:Srprb UTSW 9 103197556 missense probably damaging 0.99
R2851:Srprb UTSW 9 103198839 nonsense probably null
R2853:Srprb UTSW 9 103198839 nonsense probably null
R4161:Srprb UTSW 9 103201330 missense possibly damaging 0.88
R4914:Srprb UTSW 9 103201948 missense possibly damaging 0.59
R5260:Srprb UTSW 9 103201920 missense probably damaging 1.00
R5588:Srprb UTSW 9 103198849 nonsense probably null
R6052:Srprb UTSW 9 103190216 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GGTTCATCCCATACCAGTGTC -3'
(R):5'- GCCTCACATATACTAGGCAAGC -3'

Sequencing Primer
(F):5'- CCAGTGTCAAAAGTCTTGGC -3'
(R):5'- CACCTGTGTTTACTATTAAGACATCC -3'
Posted On2016-11-08