Incidental Mutation 'R5624:Myo1c'
ID441747
Institutional Source Beutler Lab
Gene Symbol Myo1c
Ensembl Gene ENSMUSG00000017774
Gene Namemyosin IC
SynonymsC80397, myosin-Ibeta, myr2, mm1beta
MMRRC Submission 043163-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.663) question?
Stock #R5624 (G1)
Quality Score219
Status Validated
Chromosome11
Chromosomal Location75650504-75673910 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75662635 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 516 (T516A)
Ref Sequence ENSEMBL: ENSMUSP00000099563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069057] [ENSMUST00000102504] [ENSMUST00000102505] [ENSMUST00000108431] [ENSMUST00000136935]
Predicted Effect probably damaging
Transcript: ENSMUST00000069057
AA Change: T481A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070388
Gene: ENSMUSG00000017774
AA Change: T481A

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102504
AA Change: T481A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099562
Gene: ENSMUSG00000017774
AA Change: T481A

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102505
AA Change: T516A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099563
Gene: ENSMUSG00000017774
AA Change: T516A

DomainStartEndE-ValueType
MYSc 40 732 N/A SMART
IQ 733 755 3.85e-3 SMART
IQ 756 778 2.09e-4 SMART
Blast:MYSc 786 815 6e-9 BLAST
low complexity region 839 850 N/A INTRINSIC
Pfam:Myosin_TH1 874 1052 2.9e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108431
AA Change: T497A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104069
Gene: ENSMUSG00000017774
AA Change: T497A

DomainStartEndE-ValueType
MYSc 21 713 N/A SMART
IQ 714 736 3.85e-3 SMART
IQ 737 759 2.09e-4 SMART
Blast:MYSc 767 796 5e-9 BLAST
low complexity region 820 831 N/A INTRINSIC
Pfam:Myosin_TH1 854 1040 3.3e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123064
Predicted Effect probably benign
Transcript: ENSMUST00000136935
SMART Domains Protein: ENSMUSP00000121267
Gene: ENSMUSG00000017774

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
PDB:4BYF|C 39 80 5e-21 PDB
Blast:MYSc 43 80 9e-19 BLAST
SCOP:d1lkxa_ 50 80 3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151174
Meta Mutation Damage Score 0.1046 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: This gene encodes a member of the unconventional myosin protein family, which are actin-based molecular motors. The protein is found in the cytoplasm, and one isoform with a unique N-terminus is also found in the nucleus. The protein functions in intracellular vesicle transport to the plasma membrane. The nuclear isoform associates with RNA polymerase I and II and functions in transcription initiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in (Y61G) mutation that sensitizes to N6-modified ADP analogs display altered fast adaption in vestibular hair cells. Mice homozygous for a nuclear isoform-specifc knock-out allele exhibit minor changes in bone marrow density and red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T A 8: 119,615,105 probably null Het
Aoah A T 13: 20,995,479 N372I probably damaging Het
Ash1l T A 3: 88,985,609 D1598E probably damaging Het
Bcas2 T C 3: 103,173,261 C72R probably benign Het
Car9 T A 4: 43,509,146 F238Y probably benign Het
Ccnd1 T C 7: 144,938,012 S97G probably benign Het
Cfap52 C G 11: 67,927,358 C509S possibly damaging Het
Clcn4 C A 7: 7,288,944 V623L probably benign Het
Dnajc11 T C 4: 151,979,510 V483A probably benign Het
E2f8 G T 7: 48,877,961 D144E probably damaging Het
Epb41l1 G A 2: 156,533,771 probably benign Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam208b A G 13: 3,584,996 S604P possibly damaging Het
Fhit A G 14: 10,421,534 S85P probably damaging Het
Fzd8 G A 18: 9,213,268 G117S unknown Het
Gsdmc4 A G 15: 63,892,654 M379T possibly damaging Het
Hemk1 T C 9: 107,331,528 R157G probably benign Het
Il10 A G 1: 131,024,203 M158V probably benign Het
Jmjd1c G A 10: 67,233,414 M1656I probably damaging Het
Kit A T 5: 75,609,394 K155N probably benign Het
Lmtk3 C A 7: 45,786,862 A114E probably damaging Het
Lztr1 A G 16: 17,512,129 probably benign Het
Mras A G 9: 99,411,485 F34S probably damaging Het
Nme8 A C 13: 19,677,868 V197G possibly damaging Het
Olfr1089 T C 2: 86,732,805 D269G probably benign Het
Olfr1339 T A 4: 118,735,371 Y281N probably damaging Het
Pcdhb9 A T 18: 37,401,406 Y151F probably benign Het
Pcnx2 C T 8: 125,761,523 probably null Het
Plekhg4 T C 8: 105,380,750 F892S probably damaging Het
Prmt3 T A 7: 49,780,334 F62I probably damaging Het
Ralgapa1 T C 12: 55,612,738 Y1999C probably damaging Het
Rims2 A T 15: 39,345,413 Q204L possibly damaging Het
Slc6a16 T G 7: 45,261,108 H352Q probably benign Het
Snx9 T A 17: 5,891,809 C70* probably null Het
Srprb A G 9: 103,197,601 I114T probably damaging Het
Tas2r119 A T 15: 32,177,968 I227F probably damaging Het
Tg A T 15: 66,838,057 Y163F probably benign Het
Tm2d2 A G 8: 25,022,768 T211A probably damaging Het
Tmem132b A G 5: 125,622,646 S83G probably benign Het
Trav9-4 T C 14: 53,676,429 S47P probably benign Het
Vmn2r8 T A 5: 108,802,459 H174L probably damaging Het
Xrcc1 A G 7: 24,559,845 D85G possibly damaging Het
Zfp106 C G 2: 120,531,957 A34P probably damaging Het
Zfp608 A T 18: 54,898,272 N865K probably damaging Het
Zscan5b A G 7: 6,230,519 D114G probably benign Het
Other mutations in Myo1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Myo1c APN 11 75672250 missense probably damaging 1.00
IGL02054:Myo1c APN 11 75661136 missense probably benign 0.30
IGL02115:Myo1c APN 11 75661591 missense probably damaging 0.99
IGL02375:Myo1c APN 11 75661574 missense probably benign 0.00
IGL02878:Myo1c APN 11 75669033 missense possibly damaging 0.93
IGL03008:Myo1c APN 11 75658414 missense probably benign 0.13
Sweeper UTSW 11 75670030 nonsense probably null
R0070:Myo1c UTSW 11 75660250 missense probably benign 0.39
R0070:Myo1c UTSW 11 75660250 missense probably benign 0.39
R0138:Myo1c UTSW 11 75661001 missense possibly damaging 0.92
R0200:Myo1c UTSW 11 75672182 missense probably benign 0.00
R0227:Myo1c UTSW 11 75658694 missense probably benign 0.34
R0257:Myo1c UTSW 11 75665516 critical splice acceptor site probably null
R0513:Myo1c UTSW 11 75665831 splice site probably null
R0587:Myo1c UTSW 11 75657790 missense probably damaging 1.00
R0667:Myo1c UTSW 11 75668512 missense probably damaging 1.00
R1469:Myo1c UTSW 11 75669961 missense probably damaging 1.00
R1469:Myo1c UTSW 11 75669961 missense probably damaging 1.00
R1793:Myo1c UTSW 11 75657589 missense probably damaging 0.98
R1922:Myo1c UTSW 11 75668229 missense probably benign
R2000:Myo1c UTSW 11 75670579 missense probably damaging 1.00
R3983:Myo1c UTSW 11 75661499 missense probably benign 0.05
R4583:Myo1c UTSW 11 75671862 missense possibly damaging 0.72
R4599:Myo1c UTSW 11 75668193 missense probably damaging 0.99
R4671:Myo1c UTSW 11 75670030 nonsense probably null
R4682:Myo1c UTSW 11 75670030 nonsense probably null
R4708:Myo1c UTSW 11 75670030 nonsense probably null
R4709:Myo1c UTSW 11 75670030 nonsense probably null
R4742:Myo1c UTSW 11 75670030 nonsense probably null
R4770:Myo1c UTSW 11 75660313 nonsense probably null
R4888:Myo1c UTSW 11 75669227 missense probably damaging 1.00
R4915:Myo1c UTSW 11 75656309 start codon destroyed probably null
R4934:Myo1c UTSW 11 75671850 missense probably damaging 1.00
R4971:Myo1c UTSW 11 75671588 missense probably damaging 1.00
R5319:Myo1c UTSW 11 75662026 missense possibly damaging 0.95
R5589:Myo1c UTSW 11 75657588 missense possibly damaging 0.74
R5756:Myo1c UTSW 11 75658414 missense probably benign 0.42
R5959:Myo1c UTSW 11 75657519 missense probably benign 0.37
R6160:Myo1c UTSW 11 75650742 missense probably benign 0.00
R6559:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6568:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6569:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6574:Myo1c UTSW 11 75656298 start gained probably benign
R6579:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6580:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6583:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6640:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6642:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6643:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6679:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6680:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6687:Myo1c UTSW 11 75672201 missense probably benign
R6695:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6696:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6700:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6712:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6713:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6715:Myo1c UTSW 11 75671635 missense probably benign 0.42
R7081:Myo1c UTSW 11 75660963 missense probably benign
R7265:Myo1c UTSW 11 75669790 missense possibly damaging 0.89
R7397:Myo1c UTSW 11 75671242 missense probably benign 0.17
R7586:Myo1c UTSW 11 75657519 missense possibly damaging 0.77
R7714:Myo1c UTSW 11 75658693 missense probably damaging 1.00
R8260:Myo1c UTSW 11 75656116 unclassified probably benign
R8341:Myo1c UTSW 11 75671427 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- ACAGGGCTCCCTAAACTCTG -3'
(R):5'- TGGTGGCTTTCTACAACTGTCC -3'

Sequencing Primer
(F):5'- GCTCCCTAAACTCTGCCCCC -3'
(R):5'- TCTCTGGTGAACAACTTGTAGC -3'
Posted On2016-11-08