Incidental Mutation 'R5624:Fhit'
ID441752
Institutional Source Beutler Lab
Gene Symbol Fhit
Ensembl Gene ENSMUSG00000060579
Gene Namefragile histidine triad gene
SynonymsFra14A2
MMRRC Submission 043163-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R5624 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location9550092-11162035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10421534 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 85 (S85P)
Ref Sequence ENSEMBL: ENSMUSP00000124017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160340] [ENSMUST00000160956] [ENSMUST00000161302] [ENSMUST00000161895] [ENSMUST00000162278] [ENSMUST00000162817] [ENSMUST00000179394]
Predicted Effect probably damaging
Transcript: ENSMUST00000160340
AA Change: S85P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124017
Gene: ENSMUSG00000060579
AA Change: S85P

DomainStartEndE-ValueType
Pfam:DcpS_C 60 170 2e-9 PFAM
Pfam:HIT 72 168 6.8e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160956
AA Change: S22P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123820
Gene: ENSMUSG00000060579
AA Change: S22P

DomainStartEndE-ValueType
Pfam:HIT 9 57 6.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161179
Predicted Effect probably damaging
Transcript: ENSMUST00000161302
AA Change: S22P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123874
Gene: ENSMUSG00000060579
AA Change: S22P

DomainStartEndE-ValueType
Pfam:DcpS_C 7 110 8.2e-10 PFAM
Pfam:HIT 9 105 4.9e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161895
AA Change: S22P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124957
Gene: ENSMUSG00000060579
AA Change: S22P

DomainStartEndE-ValueType
Pfam:DcpS_C 6 110 4.3e-10 PFAM
Pfam:HIT 9 105 2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162278
AA Change: S22P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124073
Gene: ENSMUSG00000060579
AA Change: S22P

DomainStartEndE-ValueType
Pfam:DcpS_C 7 110 8.2e-10 PFAM
Pfam:HIT 9 105 4.9e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162817
AA Change: S22P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124500
Gene: ENSMUSG00000060579
AA Change: S22P

DomainStartEndE-ValueType
Pfam:DcpS_C 5 100 2.3e-7 PFAM
Pfam:HIT 9 100 1.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179394
AA Change: S22P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136011
Gene: ENSMUSG00000060579
AA Change: S22P

DomainStartEndE-ValueType
Pfam:DcpS_C 7 110 8.2e-10 PFAM
Pfam:HIT 9 105 4.9e-28 PFAM
Meta Mutation Damage Score 0.9218 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: This gene encodes a member of the HIT family of proteins that are characterized by the presence of a histidine triad sequence. The encoded protein is a diadenosine triphosphate hydrolase enzyme that cleaves the P(1)-P(3)-bis(5'-adenosyl) triphosphate (Ap3A) to yield AMP and ADP. This locus is very fragile and has been found to be altered in different types of cancers. Mice lacking the encoded protein display increased susceptibility to spontaneous and induced tumors. Ectopic expression of the encoded protein in such knockout mice inhibits tumor development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Both homozygotes and heterozygotes for a targeted null mutation exhibit a similarly increased incidence of both spontaneous and nitrosomethylbenzalamine-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T A 8: 119,615,105 probably null Het
Aoah A T 13: 20,995,479 N372I probably damaging Het
Ash1l T A 3: 88,985,609 D1598E probably damaging Het
Bcas2 T C 3: 103,173,261 C72R probably benign Het
Car9 T A 4: 43,509,146 F238Y probably benign Het
Ccnd1 T C 7: 144,938,012 S97G probably benign Het
Cfap52 C G 11: 67,927,358 C509S possibly damaging Het
Clcn4 C A 7: 7,288,944 V623L probably benign Het
Dnajc11 T C 4: 151,979,510 V483A probably benign Het
E2f8 G T 7: 48,877,961 D144E probably damaging Het
Epb41l1 G A 2: 156,533,771 probably benign Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam208b A G 13: 3,584,996 S604P possibly damaging Het
Fzd8 G A 18: 9,213,268 G117S unknown Het
Gsdmc4 A G 15: 63,892,654 M379T possibly damaging Het
Hemk1 T C 9: 107,331,528 R157G probably benign Het
Il10 A G 1: 131,024,203 M158V probably benign Het
Jmjd1c G A 10: 67,233,414 M1656I probably damaging Het
Kit A T 5: 75,609,394 K155N probably benign Het
Lmtk3 C A 7: 45,786,862 A114E probably damaging Het
Lztr1 A G 16: 17,512,129 probably benign Het
Mras A G 9: 99,411,485 F34S probably damaging Het
Myo1c A G 11: 75,662,635 T516A probably damaging Het
Nme8 A C 13: 19,677,868 V197G possibly damaging Het
Olfr1089 T C 2: 86,732,805 D269G probably benign Het
Olfr1339 T A 4: 118,735,371 Y281N probably damaging Het
Pcdhb9 A T 18: 37,401,406 Y151F probably benign Het
Pcnx2 C T 8: 125,761,523 probably null Het
Plekhg4 T C 8: 105,380,750 F892S probably damaging Het
Prmt3 T A 7: 49,780,334 F62I probably damaging Het
Ralgapa1 T C 12: 55,612,738 Y1999C probably damaging Het
Rims2 A T 15: 39,345,413 Q204L possibly damaging Het
Slc6a16 T G 7: 45,261,108 H352Q probably benign Het
Snx9 T A 17: 5,891,809 C70* probably null Het
Srprb A G 9: 103,197,601 I114T probably damaging Het
Tas2r119 A T 15: 32,177,968 I227F probably damaging Het
Tg A T 15: 66,838,057 Y163F probably benign Het
Tm2d2 A G 8: 25,022,768 T211A probably damaging Het
Tmem132b A G 5: 125,622,646 S83G probably benign Het
Trav9-4 T C 14: 53,676,429 S47P probably benign Het
Vmn2r8 T A 5: 108,802,459 H174L probably damaging Het
Xrcc1 A G 7: 24,559,845 D85G possibly damaging Het
Zfp106 C G 2: 120,531,957 A34P probably damaging Het
Zfp608 A T 18: 54,898,272 N865K probably damaging Het
Zscan5b A G 7: 6,230,519 D114G probably benign Het
Other mutations in Fhit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Fhit APN 14 9573483 missense probably benign 0.19
IGL01412:Fhit APN 14 9870065 missense probably damaging 1.00
IGL02831:Fhit APN 14 9870080 missense probably benign 0.00
IGL03025:Fhit APN 14 10421534 missense probably damaging 1.00
overtax UTSW 14 10421534 missense probably damaging 1.00
R0464:Fhit UTSW 14 10991567 start gained probably benign
R0544:Fhit UTSW 14 9870172 missense probably damaging 1.00
R3545:Fhit UTSW 14 9870095 missense probably benign 0.03
R3547:Fhit UTSW 14 9870095 missense probably benign 0.03
R3548:Fhit UTSW 14 9870095 missense probably benign 0.03
R4033:Fhit UTSW 14 10751671 intron probably benign
R4685:Fhit UTSW 14 9870091 missense probably damaging 1.00
R4968:Fhit UTSW 14 10421522 missense probably damaging 1.00
R6011:Fhit UTSW 14 9870068 missense probably benign 0.16
R6061:Fhit UTSW 14 9573435 missense probably benign 0.00
R6208:Fhit UTSW 14 9573435 missense probably benign 0.00
R6846:Fhit UTSW 14 9763762 missense possibly damaging 0.73
R7288:Fhit UTSW 14 9763784 missense probably damaging 1.00
R7625:Fhit UTSW 14 9870177 critical splice acceptor site probably null
R8094:Fhit UTSW 14 10751666 missense unknown
Z1177:Fhit UTSW 14 9870128 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGAATAACATCTTACCTGGACACTCC -3'
(R):5'- CTGGAGTTCATCTGAGGGAC -3'

Sequencing Primer
(F):5'- CCAAAGCAGGAGGAAGGGAGATTC -3'
(R):5'- GGGATCCCATTCTATCAAAGAGTC -3'
Posted On2016-11-08