Incidental Mutation 'R5624:Tas2r119'
ID441754
Institutional Source Beutler Lab
Gene Symbol Tas2r119
Ensembl Gene ENSMUSG00000045267
Gene Nametaste receptor, type 2, member 119
SynonymsmGR19, T2R19, mt2r19, Tas2r19
MMRRC Submission 043163-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5624 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location32177289-32178294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32177968 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 227 (I227F)
Ref Sequence ENSEMBL: ENSMUSP00000050277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057633]
Predicted Effect probably damaging
Transcript: ENSMUST00000057633
AA Change: I227F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050277
Gene: ENSMUSG00000045267
AA Change: I227F

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 1.1e-90 PFAM
Meta Mutation Damage Score 0.6386 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily and that are specifically expressed by taste receptor cells of the tongue and palate epithelia. This intronless taste receptor gene encodes a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is mapped to chromosome 5p15, the location of a genetic locus (PROP) that controls the detection of the bitter compound 6-n-propyl-2-thiouracil. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T A 8: 119,615,105 probably null Het
Aoah A T 13: 20,995,479 N372I probably damaging Het
Ash1l T A 3: 88,985,609 D1598E probably damaging Het
Bcas2 T C 3: 103,173,261 C72R probably benign Het
Car9 T A 4: 43,509,146 F238Y probably benign Het
Ccnd1 T C 7: 144,938,012 S97G probably benign Het
Cfap52 C G 11: 67,927,358 C509S possibly damaging Het
Clcn4 C A 7: 7,288,944 V623L probably benign Het
Dnajc11 T C 4: 151,979,510 V483A probably benign Het
E2f8 G T 7: 48,877,961 D144E probably damaging Het
Epb41l1 G A 2: 156,533,771 probably benign Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam208b A G 13: 3,584,996 S604P possibly damaging Het
Fhit A G 14: 10,421,534 S85P probably damaging Het
Fzd8 G A 18: 9,213,268 G117S unknown Het
Gsdmc4 A G 15: 63,892,654 M379T possibly damaging Het
Hemk1 T C 9: 107,331,528 R157G probably benign Het
Il10 A G 1: 131,024,203 M158V probably benign Het
Jmjd1c G A 10: 67,233,414 M1656I probably damaging Het
Kit A T 5: 75,609,394 K155N probably benign Het
Lmtk3 C A 7: 45,786,862 A114E probably damaging Het
Lztr1 A G 16: 17,512,129 probably benign Het
Mras A G 9: 99,411,485 F34S probably damaging Het
Myo1c A G 11: 75,662,635 T516A probably damaging Het
Nme8 A C 13: 19,677,868 V197G possibly damaging Het
Olfr1089 T C 2: 86,732,805 D269G probably benign Het
Olfr1339 T A 4: 118,735,371 Y281N probably damaging Het
Pcdhb9 A T 18: 37,401,406 Y151F probably benign Het
Pcnx2 C T 8: 125,761,523 probably null Het
Plekhg4 T C 8: 105,380,750 F892S probably damaging Het
Prmt3 T A 7: 49,780,334 F62I probably damaging Het
Ralgapa1 T C 12: 55,612,738 Y1999C probably damaging Het
Rims2 A T 15: 39,345,413 Q204L possibly damaging Het
Slc6a16 T G 7: 45,261,108 H352Q probably benign Het
Snx9 T A 17: 5,891,809 C70* probably null Het
Srprb A G 9: 103,197,601 I114T probably damaging Het
Tg A T 15: 66,838,057 Y163F probably benign Het
Tm2d2 A G 8: 25,022,768 T211A probably damaging Het
Tmem132b A G 5: 125,622,646 S83G probably benign Het
Trav9-4 T C 14: 53,676,429 S47P probably benign Het
Vmn2r8 T A 5: 108,802,459 H174L probably damaging Het
Xrcc1 A G 7: 24,559,845 D85G possibly damaging Het
Zfp106 C G 2: 120,531,957 A34P probably damaging Het
Zfp608 A T 18: 54,898,272 N865K probably damaging Het
Zscan5b A G 7: 6,230,519 D114G probably benign Het
Other mutations in Tas2r119
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Tas2r119 APN 15 32177453 missense probably damaging 0.97
IGL01522:Tas2r119 APN 15 32178193 missense probably benign 0.15
IGL01548:Tas2r119 APN 15 32177977 missense probably damaging 1.00
IGL01826:Tas2r119 APN 15 32177402 missense probably damaging 1.00
IGL02432:Tas2r119 APN 15 32177707 missense probably benign 0.06
IGL02585:Tas2r119 APN 15 32177533 missense probably benign 0.04
R2248:Tas2r119 UTSW 15 32178151 missense possibly damaging 0.51
R2432:Tas2r119 UTSW 15 32178019 missense possibly damaging 0.80
R5098:Tas2r119 UTSW 15 32178082 missense probably benign 0.03
R5819:Tas2r119 UTSW 15 32177306 missense probably damaging 1.00
R5901:Tas2r119 UTSW 15 32177786 missense possibly damaging 0.84
R6363:Tas2r119 UTSW 15 32177888 missense possibly damaging 0.91
R6495:Tas2r119 UTSW 15 32177530 missense probably benign
R6521:Tas2r119 UTSW 15 32178173 missense probably damaging 1.00
R7574:Tas2r119 UTSW 15 32178133 missense probably damaging 1.00
X0063:Tas2r119 UTSW 15 32178155 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCATGCCACACTACTCTCAGTC -3'
(R):5'- TTGAGGTGACCCAAGCTCTTG -3'

Sequencing Primer
(F):5'- ACACTACTCTCAGTCTTTGTCTTTGG -3'
(R):5'- GTGACCCAAGCTCTTGCACAATG -3'
Posted On2016-11-08