Incidental Mutation 'R5624:Gsdmc4'
ID441756
Institutional Source Beutler Lab
Gene Symbol Gsdmc4
Ensembl Gene ENSMUSG00000055748
Gene Namegasdermin C4
Synonyms9030605I04Rik
MMRRC Submission 043163-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5624 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location63891264-63912297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63892654 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 379 (M379T)
Ref Sequence ENSEMBL: ENSMUSP00000140269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063530] [ENSMUST00000188108]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063530
AA Change: M379T

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066072
Gene: ENSMUSG00000055748
AA Change: M379T

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.2e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177709
SMART Domains Protein: ENSMUSP00000137240
Gene: ENSMUSG00000093867

DomainStartEndE-ValueType
Pfam:Gasdermin 4 161 2.1e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186026
Predicted Effect possibly damaging
Transcript: ENSMUST00000188108
AA Change: M379T

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140269
Gene: ENSMUSG00000055748
AA Change: M379T

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 3.8e-153 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T A 8: 119,615,105 probably null Het
Aoah A T 13: 20,995,479 N372I probably damaging Het
Ash1l T A 3: 88,985,609 D1598E probably damaging Het
Bcas2 T C 3: 103,173,261 C72R probably benign Het
Car9 T A 4: 43,509,146 F238Y probably benign Het
Ccnd1 T C 7: 144,938,012 S97G probably benign Het
Cfap52 C G 11: 67,927,358 C509S possibly damaging Het
Clcn4 C A 7: 7,288,944 V623L probably benign Het
Dnajc11 T C 4: 151,979,510 V483A probably benign Het
E2f8 G T 7: 48,877,961 D144E probably damaging Het
Epb41l1 G A 2: 156,533,771 probably benign Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam208b A G 13: 3,584,996 S604P possibly damaging Het
Fhit A G 14: 10,421,534 S85P probably damaging Het
Fzd8 G A 18: 9,213,268 G117S unknown Het
Hemk1 T C 9: 107,331,528 R157G probably benign Het
Il10 A G 1: 131,024,203 M158V probably benign Het
Jmjd1c G A 10: 67,233,414 M1656I probably damaging Het
Kit A T 5: 75,609,394 K155N probably benign Het
Lmtk3 C A 7: 45,786,862 A114E probably damaging Het
Lztr1 A G 16: 17,512,129 probably benign Het
Mras A G 9: 99,411,485 F34S probably damaging Het
Myo1c A G 11: 75,662,635 T516A probably damaging Het
Nme8 A C 13: 19,677,868 V197G possibly damaging Het
Olfr1089 T C 2: 86,732,805 D269G probably benign Het
Olfr1339 T A 4: 118,735,371 Y281N probably damaging Het
Pcdhb9 A T 18: 37,401,406 Y151F probably benign Het
Pcnx2 C T 8: 125,761,523 probably null Het
Plekhg4 T C 8: 105,380,750 F892S probably damaging Het
Prmt3 T A 7: 49,780,334 F62I probably damaging Het
Ralgapa1 T C 12: 55,612,738 Y1999C probably damaging Het
Rims2 A T 15: 39,345,413 Q204L possibly damaging Het
Slc6a16 T G 7: 45,261,108 H352Q probably benign Het
Snx9 T A 17: 5,891,809 C70* probably null Het
Srprb A G 9: 103,197,601 I114T probably damaging Het
Tas2r119 A T 15: 32,177,968 I227F probably damaging Het
Tg A T 15: 66,838,057 Y163F probably benign Het
Tm2d2 A G 8: 25,022,768 T211A probably damaging Het
Tmem132b A G 5: 125,622,646 S83G probably benign Het
Trav9-4 T C 14: 53,676,429 S47P probably benign Het
Vmn2r8 T A 5: 108,802,459 H174L probably damaging Het
Xrcc1 A G 7: 24,559,845 D85G possibly damaging Het
Zfp106 C G 2: 120,531,957 A34P probably damaging Het
Zfp608 A T 18: 54,898,272 N865K probably damaging Het
Zscan5b A G 7: 6,230,519 D114G probably benign Het
Other mutations in Gsdmc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Gsdmc4 APN 15 63897804 missense probably damaging 1.00
IGL02301:Gsdmc4 APN 15 63895264 missense probably benign 0.00
IGL02586:Gsdmc4 APN 15 63893792 missense probably damaging 0.98
IGL02747:Gsdmc4 APN 15 63893871 missense probably benign 0.04
IGL02829:Gsdmc4 APN 15 63892648 missense probably benign 0.01
IGL03233:Gsdmc4 APN 15 63902860 missense probably damaging 1.00
R0835:Gsdmc4 UTSW 15 63893800 missense probably damaging 1.00
R0981:Gsdmc4 UTSW 15 63892073 missense probably damaging 1.00
R1946:Gsdmc4 UTSW 15 63902780 missense probably benign 0.19
R2350:Gsdmc4 UTSW 15 63893165 missense probably benign
R2967:Gsdmc4 UTSW 15 63902060 missense probably benign 0.19
R3409:Gsdmc4 UTSW 15 63892046 missense probably benign 0.09
R3410:Gsdmc4 UTSW 15 63892046 missense probably benign 0.09
R4067:Gsdmc4 UTSW 15 63893887 splice site probably null
R4840:Gsdmc4 UTSW 15 63893747 missense probably benign 0.24
R5182:Gsdmc4 UTSW 15 63893804 missense probably damaging 1.00
R5910:Gsdmc4 UTSW 15 63895252 missense possibly damaging 0.77
R6533:Gsdmc4 UTSW 15 63892060 missense probably damaging 1.00
R6698:Gsdmc4 UTSW 15 63893764 missense probably benign 0.10
R7291:Gsdmc4 UTSW 15 63902840 missense possibly damaging 0.81
R7598:Gsdmc4 UTSW 15 63900386 missense probably damaging 1.00
R7691:Gsdmc4 UTSW 15 63893791 missense probably damaging 1.00
R7851:Gsdmc4 UTSW 15 63902746 nonsense probably null
R7881:Gsdmc4 UTSW 15 63897719 missense possibly damaging 0.91
R8300:Gsdmc4 UTSW 15 63894941 missense probably damaging 0.97
R8512:Gsdmc4 UTSW 15 63891959 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAAGGCTTCCATAACTGC -3'
(R):5'- ATGAGCCTGGAGCCCATATC -3'

Sequencing Primer
(F):5'- TAACTGCAGAGATGCTCCTG -3'
(R):5'- CCCATATCAAGGGCTGGAGAC -3'
Posted On2016-11-08