Incidental Mutation 'R5624:Lztr1'
ID441759
Institutional Source Beutler Lab
Gene Symbol Lztr1
Ensembl Gene ENSMUSG00000022761
Gene Nameleucine-zipper-like transcriptional regulator, 1
Synonyms1200003E21Rik, TCFL2
MMRRC Submission 043163-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5624 (G1)
Quality Score126
Status Validated
Chromosome16
Chromosomal Location17508688-17526333 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 17512129 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023444] [ENSMUST00000023448] [ENSMUST00000115681] [ENSMUST00000115685] [ENSMUST00000231292] [ENSMUST00000232242] [ENSMUST00000231994] [ENSMUST00000232372]
Predicted Effect probably benign
Transcript: ENSMUST00000023444
SMART Domains Protein: ENSMUSP00000023444
Gene: ENSMUSG00000022761

DomainStartEndE-ValueType
Pfam:Kelch_6 64 103 1.1e-7 PFAM
Pfam:Kelch_1 64 105 1.7e-7 PFAM
Pfam:Kelch_4 64 113 4.7e-10 PFAM
Pfam:Kelch_3 74 123 3.1e-10 PFAM
Pfam:Kelch_5 111 152 7.2e-9 PFAM
Pfam:Kelch_1 114 161 2.8e-7 PFAM
Pfam:Kelch_2 114 163 1e-7 PFAM
Pfam:Kelch_4 114 170 1.9e-6 PFAM
Pfam:Kelch_3 124 180 9.1e-9 PFAM
Pfam:Kelch_4 171 224 6.1e-6 PFAM
Pfam:Kelch_3 181 232 6e-7 PFAM
Pfam:Kelch_1 224 267 1e-6 PFAM
Pfam:Kelch_4 225 278 6.2e-6 PFAM
Pfam:Kelch_3 234 289 2.2e-8 PFAM
Pfam:Kelch_1 280 325 7.7e-10 PFAM
Pfam:Kelch_2 280 325 4.3e-7 PFAM
Pfam:Kelch_6 280 325 9.6e-9 PFAM
Pfam:Kelch_4 280 329 2.5e-8 PFAM
BTB 440 571 4.16e-4 SMART
BTB 664 765 2.95e-18 SMART
low complexity region 808 821 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023448
SMART Domains Protein: ENSMUSP00000023448
Gene: ENSMUSG00000022763

DomainStartEndE-ValueType
Pfam:Rieske 68 161 3.6e-18 PFAM
Pfam:Rieske_2 70 166 7.7e-11 PFAM
Pfam:Pyr_redox_2 196 473 1.1e-34 PFAM
Pfam:Pyr_redox 334 416 7e-17 PFAM
Pfam:Reductase_C 512 591 9.4e-10 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000111345
Gene: ENSMUSG00000022761

DomainStartEndE-ValueType
Pfam:Kelch_5 63 99 1.1e-6 PFAM
Pfam:Kelch_1 64 105 1.6e-8 PFAM
Pfam:Kelch_4 64 113 5.8e-9 PFAM
Pfam:Kelch_6 64 115 2.6e-9 PFAM
Pfam:Kelch_3 74 123 2.4e-11 PFAM
Pfam:Kelch_5 111 150 5.5e-10 PFAM
Pfam:Kelch_1 114 161 5.8e-8 PFAM
Pfam:Kelch_2 114 163 3.1e-8 PFAM
Pfam:Kelch_4 114 170 1e-9 PFAM
Pfam:Kelch_3 124 180 2.5e-10 PFAM
Pfam:Kelch_5 168 204 6.1e-7 PFAM
Pfam:Kelch_4 171 224 7.9e-8 PFAM
Pfam:Kelch_3 181 233 9.1e-8 PFAM
Pfam:Kelch_4 223 279 3.1e-7 PFAM
Pfam:Kelch_1 224 267 1.9e-6 PFAM
Pfam:Kelch_3 234 289 1.5e-8 PFAM
Pfam:Kelch_1 280 325 2.9e-10 PFAM
Pfam:Kelch_2 280 325 1.3e-7 PFAM
Pfam:Kelch_6 280 326 2.4e-9 PFAM
Pfam:Kelch_4 280 335 1.7e-9 PFAM
Pfam:Kelch_5 381 419 2.8e-7 PFAM
BTB 440 571 4.16e-4 SMART
BTB 664 797 1.7e-18 SMART
low complexity region 808 821 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115685
SMART Domains Protein: ENSMUSP00000111349
Gene: ENSMUSG00000022763

DomainStartEndE-ValueType
Pfam:Rieske 68 161 6.5e-23 PFAM
Pfam:Rieske_2 70 166 1.4e-10 PFAM
Pfam:Pyr_redox_2 195 493 1.6e-65 PFAM
Pfam:Pyr_redox 334 416 7.3e-18 PFAM
Pfam:Reductase_C 512 586 9.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152077
Predicted Effect probably benign
Transcript: ENSMUST00000231292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231538
Predicted Effect probably benign
Transcript: ENSMUST00000232242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232644
Predicted Effect probably benign
Transcript: ENSMUST00000231994
Predicted Effect probably benign
Transcript: ENSMUST00000232372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232379
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: This gene encodes a member of the BR-C, ttk and bab-kelch superfamily that, in humans, localizes to the Golgi network and is associated with the ras / mitogen-activated protein kinase pathway. Loss-of-function mutations in the human ortholog are associated with glioblastoma multiforme, schwannomatosis, Noonan syndrome, and DiGeorge syndrome. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T A 8: 119,615,105 probably null Het
Aoah A T 13: 20,995,479 N372I probably damaging Het
Ash1l T A 3: 88,985,609 D1598E probably damaging Het
Bcas2 T C 3: 103,173,261 C72R probably benign Het
Car9 T A 4: 43,509,146 F238Y probably benign Het
Ccnd1 T C 7: 144,938,012 S97G probably benign Het
Cfap52 C G 11: 67,927,358 C509S possibly damaging Het
Clcn4 C A 7: 7,288,944 V623L probably benign Het
Dnajc11 T C 4: 151,979,510 V483A probably benign Het
E2f8 G T 7: 48,877,961 D144E probably damaging Het
Epb41l1 G A 2: 156,533,771 probably benign Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam208b A G 13: 3,584,996 S604P possibly damaging Het
Fhit A G 14: 10,421,534 S85P probably damaging Het
Fzd8 G A 18: 9,213,268 G117S unknown Het
Gsdmc4 A G 15: 63,892,654 M379T possibly damaging Het
Hemk1 T C 9: 107,331,528 R157G probably benign Het
Il10 A G 1: 131,024,203 M158V probably benign Het
Jmjd1c G A 10: 67,233,414 M1656I probably damaging Het
Kit A T 5: 75,609,394 K155N probably benign Het
Lmtk3 C A 7: 45,786,862 A114E probably damaging Het
Mras A G 9: 99,411,485 F34S probably damaging Het
Myo1c A G 11: 75,662,635 T516A probably damaging Het
Nme8 A C 13: 19,677,868 V197G possibly damaging Het
Olfr1089 T C 2: 86,732,805 D269G probably benign Het
Olfr1339 T A 4: 118,735,371 Y281N probably damaging Het
Pcdhb9 A T 18: 37,401,406 Y151F probably benign Het
Pcnx2 C T 8: 125,761,523 probably null Het
Plekhg4 T C 8: 105,380,750 F892S probably damaging Het
Prmt3 T A 7: 49,780,334 F62I probably damaging Het
Ralgapa1 T C 12: 55,612,738 Y1999C probably damaging Het
Rims2 A T 15: 39,345,413 Q204L possibly damaging Het
Slc6a16 T G 7: 45,261,108 H352Q probably benign Het
Snx9 T A 17: 5,891,809 C70* probably null Het
Srprb A G 9: 103,197,601 I114T probably damaging Het
Tas2r119 A T 15: 32,177,968 I227F probably damaging Het
Tg A T 15: 66,838,057 Y163F probably benign Het
Tm2d2 A G 8: 25,022,768 T211A probably damaging Het
Tmem132b A G 5: 125,622,646 S83G probably benign Het
Trav9-4 T C 14: 53,676,429 S47P probably benign Het
Vmn2r8 T A 5: 108,802,459 H174L probably damaging Het
Xrcc1 A G 7: 24,559,845 D85G possibly damaging Het
Zfp106 C G 2: 120,531,957 A34P probably damaging Het
Zfp608 A T 18: 54,898,272 N865K probably damaging Het
Zscan5b A G 7: 6,230,519 D114G probably benign Het
Other mutations in Lztr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Lztr1 APN 16 17517450 splice site probably benign
IGL01152:Lztr1 APN 16 17522453 missense probably damaging 1.00
IGL01501:Lztr1 APN 16 17522391 splice site probably null
IGL01512:Lztr1 APN 16 17522391 splice site probably null
IGL01514:Lztr1 APN 16 17522391 splice site probably null
IGL01516:Lztr1 APN 16 17522391 splice site probably null
IGL01933:Lztr1 APN 16 17520591 missense probably damaging 1.00
IGL02603:Lztr1 APN 16 17509686 missense possibly damaging 0.77
IGL03012:Lztr1 APN 16 17521484 missense possibly damaging 0.92
IGL03191:Lztr1 APN 16 17518528 missense probably damaging 1.00
R0331:Lztr1 UTSW 16 17524237 unclassified probably benign
R0717:Lztr1 UTSW 16 17516048 splice site probably null
R1511:Lztr1 UTSW 16 17509670 missense probably damaging 1.00
R1925:Lztr1 UTSW 16 17523383 missense probably damaging 1.00
R2062:Lztr1 UTSW 16 17509670 missense probably damaging 1.00
R3694:Lztr1 UTSW 16 17509061 missense possibly damaging 0.90
R3935:Lztr1 UTSW 16 17522195 nonsense probably null
R4645:Lztr1 UTSW 16 17524091 unclassified probably benign
R7175:Lztr1 UTSW 16 17523031 missense possibly damaging 0.84
R7222:Lztr1 UTSW 16 17524132 missense possibly damaging 0.86
R7420:Lztr1 UTSW 16 17524129 missense probably damaging 1.00
R7515:Lztr1 UTSW 16 17509661 missense possibly damaging 0.87
R7516:Lztr1 UTSW 16 17509661 missense possibly damaging 0.87
R8027:Lztr1 UTSW 16 17512112 missense probably damaging 1.00
R8153:Lztr1 UTSW 16 17518575 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACTGCCTCCAACCCTAGATGC -3'
(R):5'- TAGTGATCGAAGGTCCCACC -3'

Sequencing Primer
(F):5'- AACCCTAGATGCATGCCTTC -3'
(R):5'- CAGACCAAAGGCAGCCTGTAG -3'
Posted On2016-11-08