Incidental Mutation 'R5624:Snx9'
ID441760
Institutional Source Beutler Lab
Gene Symbol Snx9
Ensembl Gene ENSMUSG00000002365
Gene Namesorting nexin 9
SynonymsSH3PX1, SDP1
MMRRC Submission 043163-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.681) question?
Stock #R5624 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location5841329-5931954 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 5891809 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 70 (C70*)
Ref Sequence ENSEMBL: ENSMUSP00000002436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002436]
PDB Structure
Solution structure of the SH3 domain from mouse sorting nexin-9 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000002436
AA Change: C70*
SMART Domains Protein: ENSMUSP00000002436
Gene: ENSMUSG00000002365
AA Change: C70*

DomainStartEndE-ValueType
SH3 3 61 1.51e-16 SMART
low complexity region 84 100 N/A INTRINSIC
low complexity region 160 170 N/A INTRINSIC
PX 247 357 4.15e-23 SMART
Pfam:BAR_3_WASP_bdg 358 593 2.4e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231803
Meta Mutation Damage Score 0.9713 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T A 8: 119,615,105 probably null Het
Aoah A T 13: 20,995,479 N372I probably damaging Het
Ash1l T A 3: 88,985,609 D1598E probably damaging Het
Bcas2 T C 3: 103,173,261 C72R probably benign Het
Car9 T A 4: 43,509,146 F238Y probably benign Het
Ccnd1 T C 7: 144,938,012 S97G probably benign Het
Cfap52 C G 11: 67,927,358 C509S possibly damaging Het
Clcn4 C A 7: 7,288,944 V623L probably benign Het
Dnajc11 T C 4: 151,979,510 V483A probably benign Het
E2f8 G T 7: 48,877,961 D144E probably damaging Het
Epb41l1 G A 2: 156,533,771 probably benign Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam208b A G 13: 3,584,996 S604P possibly damaging Het
Fhit A G 14: 10,421,534 S85P probably damaging Het
Fzd8 G A 18: 9,213,268 G117S unknown Het
Gsdmc4 A G 15: 63,892,654 M379T possibly damaging Het
Hemk1 T C 9: 107,331,528 R157G probably benign Het
Il10 A G 1: 131,024,203 M158V probably benign Het
Jmjd1c G A 10: 67,233,414 M1656I probably damaging Het
Kit A T 5: 75,609,394 K155N probably benign Het
Lmtk3 C A 7: 45,786,862 A114E probably damaging Het
Lztr1 A G 16: 17,512,129 probably benign Het
Mras A G 9: 99,411,485 F34S probably damaging Het
Myo1c A G 11: 75,662,635 T516A probably damaging Het
Nme8 A C 13: 19,677,868 V197G possibly damaging Het
Olfr1089 T C 2: 86,732,805 D269G probably benign Het
Olfr1339 T A 4: 118,735,371 Y281N probably damaging Het
Pcdhb9 A T 18: 37,401,406 Y151F probably benign Het
Pcnx2 C T 8: 125,761,523 probably null Het
Plekhg4 T C 8: 105,380,750 F892S probably damaging Het
Prmt3 T A 7: 49,780,334 F62I probably damaging Het
Ralgapa1 T C 12: 55,612,738 Y1999C probably damaging Het
Rims2 A T 15: 39,345,413 Q204L possibly damaging Het
Slc6a16 T G 7: 45,261,108 H352Q probably benign Het
Srprb A G 9: 103,197,601 I114T probably damaging Het
Tas2r119 A T 15: 32,177,968 I227F probably damaging Het
Tg A T 15: 66,838,057 Y163F probably benign Het
Tm2d2 A G 8: 25,022,768 T211A probably damaging Het
Tmem132b A G 5: 125,622,646 S83G probably benign Het
Trav9-4 T C 14: 53,676,429 S47P probably benign Het
Vmn2r8 T A 5: 108,802,459 H174L probably damaging Het
Xrcc1 A G 7: 24,559,845 D85G possibly damaging Het
Zfp106 C G 2: 120,531,957 A34P probably damaging Het
Zfp608 A T 18: 54,898,272 N865K probably damaging Het
Zscan5b A G 7: 6,230,519 D114G probably benign Het
Other mutations in Snx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Snx9 APN 17 5899361 missense probably benign
IGL00417:Snx9 APN 17 5891897 missense probably benign 0.03
IGL01827:Snx9 APN 17 5887012 missense probably benign 0.04
IGL02531:Snx9 APN 17 5891820 missense probably benign
IGL02710:Snx9 APN 17 5908598 missense probably damaging 1.00
IGL03088:Snx9 APN 17 5924610 missense probably benign
san_angelo UTSW 17 5891809 nonsense probably null
PIT4495001:Snx9 UTSW 17 5920126 missense possibly damaging 0.54
R0555:Snx9 UTSW 17 5918413 missense probably damaging 0.97
R1015:Snx9 UTSW 17 5920127 missense probably benign 0.12
R1065:Snx9 UTSW 17 5902361 splice site probably benign
R1421:Snx9 UTSW 17 5902484 missense probably benign 0.45
R1657:Snx9 UTSW 17 5918436 missense possibly damaging 0.65
R1823:Snx9 UTSW 17 5920671 missense probably damaging 1.00
R1914:Snx9 UTSW 17 5928256 missense possibly damaging 0.65
R3703:Snx9 UTSW 17 5928200 splice site probably null
R3871:Snx9 UTSW 17 5891781 missense probably benign 0.00
R4375:Snx9 UTSW 17 5908626 nonsense probably null
R4412:Snx9 UTSW 17 5908394 missense probably damaging 0.96
R4669:Snx9 UTSW 17 5927224 missense probably damaging 1.00
R4974:Snx9 UTSW 17 5902519 splice site probably null
R5038:Snx9 UTSW 17 5887073 missense probably benign 0.12
R5137:Snx9 UTSW 17 5928253 missense probably damaging 1.00
R5369:Snx9 UTSW 17 5920580 missense probably damaging 1.00
R5459:Snx9 UTSW 17 5920638 missense probably damaging 0.99
R5847:Snx9 UTSW 17 5924621 missense possibly damaging 0.94
R5953:Snx9 UTSW 17 5908402 missense probably damaging 1.00
R5953:Snx9 UTSW 17 5908403 missense probably damaging 1.00
R6263:Snx9 UTSW 17 5887049 missense probably damaging 0.98
R6481:Snx9 UTSW 17 5922209 critical splice donor site probably null
R6491:Snx9 UTSW 17 5920162 missense probably benign 0.00
R7873:Snx9 UTSW 17 5918476 missense possibly damaging 0.81
R7956:Snx9 UTSW 17 5918476 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGATTAACCAGTCACAGAGTGC -3'
(R):5'- TACTTTCAGGCAGCACCCAC -3'

Sequencing Primer
(F):5'- CAGTCACAGAGTGCTTCTCAGAG -3'
(R):5'- GCAGCACCCACAGCGATG -3'
Posted On2016-11-08