Mutagenetix > Incidental Mutations

Incidental Mutation 'R5624:Snx9'

441760

Institutional Source

Beutler Lab

Gene Symbol

Snx9

Ensembl Gene

ENSMUSG00000002365

Gene Name

sorting nexin 9

Synonyms

SH3PX1, SDP1

MMRRC Submission

043163-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.813) question?

Stock #

R5624 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5841329-5931954 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 5891809 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 70 (C70*)

Ref Sequence

ENSEMBL: ENSMUSP00000002436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002436]

PDB Structure

Solution structure of the SH3 domain from mouse sorting nexin-9 [SOLUTION NMR]

Predicted Effect

probably null
Transcript: ENSMUST00000002436
AA Change: C70*

SMART Domains

Protein: ENSMUSP00000002436
Gene: ENSMUSG00000002365
AA Change: C70*

Domain	Start	End	E-Value	Type
SH3	3	61	1.51e-16	SMART
low complexity region	84	100	N/A	INTRINSIC
low complexity region	160	170	N/A	INTRINSIC
PX	247	357	4.15e-23	SMART
Pfam:BAR_3_WASP_bdg	358	593	2.4e-120	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231803

Meta Mutation Damage Score

0.9713

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adad2	T	A	8: 119,615,105		probably null	Het
Aoah	A	T	13: 20,995,479	N372I	probably damaging	Het
Ash1l	T	A	3: 88,985,609	D1598E	probably damaging	Het
Bcas2	T	C	3: 103,173,261	C72R	probably benign	Het
Car9	T	A	4: 43,509,146	F238Y	probably benign	Het
Ccnd1	T	C	7: 144,938,012	S97G	probably benign	Het
Cfap52	C	G	11: 67,927,358	C509S	possibly damaging	Het
Clcn4	C	A	7: 7,288,944	V623L	probably benign	Het
Dnajc11	T	C	4: 151,979,510	V483A	probably benign	Het
E2f8	G	T	7: 48,877,961	D144E	probably damaging	Het
Epb41l1	G	A	2: 156,533,771		probably benign	Het
Fam186a	A	C	15: 99,941,747	H2205Q	possibly damaging	Het
Fam208b	A	G	13: 3,584,996	S604P	possibly damaging	Het
Fhit	A	G	14: 10,421,534	S85P	probably damaging	Het
Fzd8	G	A	18: 9,213,268	G117S	unknown	Het
Gsdmc4	A	G	15: 63,892,654	M379T	possibly damaging	Het
Hemk1	T	C	9: 107,331,528	R157G	probably benign	Het
Il10	A	G	1: 131,024,203	M158V	probably benign	Het
Jmjd1c	G	A	10: 67,233,414	M1656I	probably damaging	Het
Kit	A	T	5: 75,609,394	K155N	probably benign	Het
Lmtk3	C	A	7: 45,786,862	A114E	probably damaging	Het
Lztr1	A	G	16: 17,512,129		probably benign	Het
Mras	A	G	9: 99,411,485	F34S	probably damaging	Het
Myo1c	A	G	11: 75,662,635	T516A	probably damaging	Het
Nme8	A	C	13: 19,677,868	V197G	possibly damaging	Het
Olfr1089	T	C	2: 86,732,805	D269G	probably benign	Het
Olfr1339	T	A	4: 118,735,371	Y281N	probably damaging	Het
Pcdhb9	A	T	18: 37,401,406	Y151F	probably benign	Het
Pcnx2	C	T	8: 125,761,523		probably null	Het
Plekhg4	T	C	8: 105,380,750	F892S	probably damaging	Het
Prmt3	T	A	7: 49,780,334	F62I	probably damaging	Het
Ralgapa1	T	C	12: 55,612,738	Y1999C	probably damaging	Het
Rims2	A	T	15: 39,345,413	Q204L	possibly damaging	Het
Slc6a16	T	G	7: 45,261,108	H352Q	probably benign	Het
Srprb	A	G	9: 103,197,601	I114T	probably damaging	Het
Tas2r119	A	T	15: 32,177,968	I227F	probably damaging	Het
Tg	A	T	15: 66,838,057	Y163F	probably benign	Het
Tm2d2	A	G	8: 25,022,768	T211A	probably damaging	Het
Tmem132b	A	G	5: 125,622,646	S83G	probably benign	Het
Trav9-4	T	C	14: 53,676,429	S47P	probably benign	Het
Vmn2r8	T	A	5: 108,802,459	H174L	probably damaging	Het
Xrcc1	A	G	7: 24,559,845	D85G	possibly damaging	Het
Zfp106	C	G	2: 120,531,957	A34P	probably damaging	Het
Zfp608	A	T	18: 54,898,272	N865K	probably damaging	Het
Zscan5b	A	G	7: 6,230,519	D114G	probably benign	Het

Other mutations in Snx9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Snx9	APN	17	5899361	missense	probably benign
IGL00417:Snx9	APN	17	5891897	missense	probably benign	0.03
IGL01827:Snx9	APN	17	5887012	missense	probably benign	0.04
IGL02531:Snx9	APN	17	5891820	missense	probably benign
IGL02710:Snx9	APN	17	5908598	missense	probably damaging	1.00
IGL03088:Snx9	APN	17	5924610	missense	probably benign
san_angelo	UTSW	17	5891809	nonsense	probably null
PIT4495001:Snx9	UTSW	17	5920126	missense	possibly damaging	0.54
R0555:Snx9	UTSW	17	5918413	missense	probably damaging	0.97
R1015:Snx9	UTSW	17	5920127	missense	probably benign	0.12
R1065:Snx9	UTSW	17	5902361	splice site	probably benign
R1421:Snx9	UTSW	17	5902484	missense	probably benign	0.45
R1657:Snx9	UTSW	17	5918436	missense	possibly damaging	0.65
R1823:Snx9	UTSW	17	5920671	missense	probably damaging	1.00
R1914:Snx9	UTSW	17	5928256	missense	possibly damaging	0.65
R3703:Snx9	UTSW	17	5928200	splice site	probably null
R3871:Snx9	UTSW	17	5891781	missense	probably benign	0.00
R4375:Snx9	UTSW	17	5908626	nonsense	probably null
R4412:Snx9	UTSW	17	5908394	missense	probably damaging	0.96
R4669:Snx9	UTSW	17	5927224	missense	probably damaging	1.00
R4974:Snx9	UTSW	17	5902519	splice site	probably null
R5038:Snx9	UTSW	17	5887073	missense	probably benign	0.12
R5137:Snx9	UTSW	17	5928253	missense	probably damaging	1.00
R5369:Snx9	UTSW	17	5920580	missense	probably damaging	1.00
R5459:Snx9	UTSW	17	5920638	missense	probably damaging	0.99
R5847:Snx9	UTSW	17	5924621	missense	possibly damaging	0.94
R5953:Snx9	UTSW	17	5908402	missense	probably damaging	1.00
R5953:Snx9	UTSW	17	5908403	missense	probably damaging	1.00
R6263:Snx9	UTSW	17	5887049	missense	probably damaging	0.98
R6481:Snx9	UTSW	17	5922209	critical splice donor site	probably null
R6491:Snx9	UTSW	17	5920162	missense	probably benign	0.00
R7873:Snx9	UTSW	17	5918476	missense	possibly damaging	0.81
R8471:Snx9	UTSW	17	5890090	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATTAACCAGTCACAGAGTGC -3'
(R):5'- TACTTTCAGGCAGCACCCAC -3'

Sequencing Primer
(F):5'- CAGTCACAGAGTGCTTCTCAGAG -3'
(R):5'- GCAGCACCCACAGCGATG -3'

Posted On

2016-11-08