Incidental Mutation 'R5624:Fzd8'
ID441762
Institutional Source Beutler Lab
Gene Symbol Fzd8
Ensembl Gene ENSMUSG00000036904
Gene Namefrizzled class receptor 8
SynonymsmFZ8, Fz8
MMRRC Submission 043163-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5624 (G1)
Quality Score182
Status Validated
Chromosome18
Chromosomal Location9212856-9216201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 9213268 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 117 (G117S)
Ref Sequence ENSEMBL: ENSMUSP00000039660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041080]
PDB Structure
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MOUSE FRIZZLED 8 (MFZ8) [X-RAY DIFFRACTION]
Crystal structure of XWnt8 in complex with the cysteine-rich domain of Frizzled 8 [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000041080
AA Change: G117S
SMART Domains Protein: ENSMUSP00000039660
Gene: ENSMUSG00000036904
AA Change: G117S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FRI 34 153 9.06e-73 SMART
low complexity region 161 228 N/A INTRINSIC
Frizzled 264 621 1.47e-219 SMART
low complexity region 624 655 N/A INTRINSIC
Meta Mutation Damage Score 0.3082 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This gene is highly expressed in two human cancer cell lines, indicating that it may play a role in several types of cancer. The crystal structure of the extracellular cysteine-rich domain of a similar mouse protein has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T A 8: 119,615,105 probably null Het
Aoah A T 13: 20,995,479 N372I probably damaging Het
Ash1l T A 3: 88,985,609 D1598E probably damaging Het
Bcas2 T C 3: 103,173,261 C72R probably benign Het
Car9 T A 4: 43,509,146 F238Y probably benign Het
Ccnd1 T C 7: 144,938,012 S97G probably benign Het
Cfap52 C G 11: 67,927,358 C509S possibly damaging Het
Clcn4 C A 7: 7,288,944 V623L probably benign Het
Dnajc11 T C 4: 151,979,510 V483A probably benign Het
E2f8 G T 7: 48,877,961 D144E probably damaging Het
Epb41l1 G A 2: 156,533,771 probably benign Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam208b A G 13: 3,584,996 S604P possibly damaging Het
Fhit A G 14: 10,421,534 S85P probably damaging Het
Gsdmc4 A G 15: 63,892,654 M379T possibly damaging Het
Hemk1 T C 9: 107,331,528 R157G probably benign Het
Il10 A G 1: 131,024,203 M158V probably benign Het
Jmjd1c G A 10: 67,233,414 M1656I probably damaging Het
Kit A T 5: 75,609,394 K155N probably benign Het
Lmtk3 C A 7: 45,786,862 A114E probably damaging Het
Lztr1 A G 16: 17,512,129 probably benign Het
Mras A G 9: 99,411,485 F34S probably damaging Het
Myo1c A G 11: 75,662,635 T516A probably damaging Het
Nme8 A C 13: 19,677,868 V197G possibly damaging Het
Olfr1089 T C 2: 86,732,805 D269G probably benign Het
Olfr1339 T A 4: 118,735,371 Y281N probably damaging Het
Pcdhb9 A T 18: 37,401,406 Y151F probably benign Het
Pcnx2 C T 8: 125,761,523 probably null Het
Plekhg4 T C 8: 105,380,750 F892S probably damaging Het
Prmt3 T A 7: 49,780,334 F62I probably damaging Het
Ralgapa1 T C 12: 55,612,738 Y1999C probably damaging Het
Rims2 A T 15: 39,345,413 Q204L possibly damaging Het
Slc6a16 T G 7: 45,261,108 H352Q probably benign Het
Snx9 T A 17: 5,891,809 C70* probably null Het
Srprb A G 9: 103,197,601 I114T probably damaging Het
Tas2r119 A T 15: 32,177,968 I227F probably damaging Het
Tg A T 15: 66,838,057 Y163F probably benign Het
Tm2d2 A G 8: 25,022,768 T211A probably damaging Het
Tmem132b A G 5: 125,622,646 S83G probably benign Het
Trav9-4 T C 14: 53,676,429 S47P probably benign Het
Vmn2r8 T A 5: 108,802,459 H174L probably damaging Het
Xrcc1 A G 7: 24,559,845 D85G possibly damaging Het
Zfp106 C G 2: 120,531,957 A34P probably damaging Het
Zfp608 A T 18: 54,898,272 N865K probably damaging Het
Zscan5b A G 7: 6,230,519 D114G probably benign Het
Other mutations in Fzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fzd8 APN 18 9213068 missense unknown
IGL01511:Fzd8 APN 18 9213293 missense unknown
IGL03129:Fzd8 APN 18 9214270 missense probably damaging 1.00
Stilt UTSW 18 9213880 missense probably damaging 1.00
R0058:Fzd8 UTSW 18 9213985 missense possibly damaging 0.92
R0715:Fzd8 UTSW 18 9212947 missense unknown
R0966:Fzd8 UTSW 18 9214745 missense probably damaging 0.99
R1717:Fzd8 UTSW 18 9214364 missense probably damaging 1.00
R1751:Fzd8 UTSW 18 9213643 missense probably damaging 0.98
R1761:Fzd8 UTSW 18 9213643 missense probably damaging 0.98
R1905:Fzd8 UTSW 18 9213803 missense probably damaging 1.00
R1956:Fzd8 UTSW 18 9214502 missense probably damaging 1.00
R2892:Fzd8 UTSW 18 9214514 missense probably damaging 1.00
R3897:Fzd8 UTSW 18 9214939 missense possibly damaging 0.89
R3968:Fzd8 UTSW 18 9214070 missense probably damaging 0.98
R4934:Fzd8 UTSW 18 9214492 frame shift probably null
R5366:Fzd8 UTSW 18 9213880 missense probably damaging 1.00
R6261:Fzd8 UTSW 18 9214598 missense possibly damaging 0.61
R6757:Fzd8 UTSW 18 9213238 missense possibly damaging 0.78
R6758:Fzd8 UTSW 18 9213238 missense possibly damaging 0.78
R6899:Fzd8 UTSW 18 9214729 missense probably damaging 0.98
R7242:Fzd8 UTSW 18 9214171 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTACAACTACACTTACATGCCC -3'
(R):5'- TCTTGACGCGGTTGTAGAGC -3'

Sequencing Primer
(F):5'- GTTCAACCACGACACGCAAGATG -3'
(R):5'- TGGACACGCTCACCATGG -3'
Posted On2016-11-08