Incidental Mutation 'R5624:Pcdhb9'
ID441763
Institutional Source Beutler Lab
Gene Symbol Pcdhb9
Ensembl Gene ENSMUSG00000051242
Gene Nameprotocadherin beta 9
SynonymsPcdhbI, Pcdhb4C
MMRRC Submission 043163-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5624 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37400855-37403909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37401406 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 151 (Y151F)
Ref Sequence ENSEMBL: ENSMUSP00000058801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057228] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000057228
AA Change: Y151F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058801
Gene: ENSMUSG00000051242
AA Change: Y151F

DomainStartEndE-ValueType
Pfam:Cadherin_2 65 147 2.3e-33 PFAM
CA 190 275 1.28e-17 SMART
CA 299 380 7.6e-25 SMART
CA 403 484 5.81e-21 SMART
CA 508 594 9.8e-28 SMART
CA 624 705 1.86e-10 SMART
Pfam:Cadherin_C_2 722 805 2.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T A 8: 119,615,105 probably null Het
Aoah A T 13: 20,995,479 N372I probably damaging Het
Ash1l T A 3: 88,985,609 D1598E probably damaging Het
Bcas2 T C 3: 103,173,261 C72R probably benign Het
Car9 T A 4: 43,509,146 F238Y probably benign Het
Ccnd1 T C 7: 144,938,012 S97G probably benign Het
Cfap52 C G 11: 67,927,358 C509S possibly damaging Het
Clcn4 C A 7: 7,288,944 V623L probably benign Het
Dnajc11 T C 4: 151,979,510 V483A probably benign Het
E2f8 G T 7: 48,877,961 D144E probably damaging Het
Epb41l1 G A 2: 156,533,771 probably benign Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam208b A G 13: 3,584,996 S604P possibly damaging Het
Fhit A G 14: 10,421,534 S85P probably damaging Het
Fzd8 G A 18: 9,213,268 G117S unknown Het
Gsdmc4 A G 15: 63,892,654 M379T possibly damaging Het
Hemk1 T C 9: 107,331,528 R157G probably benign Het
Il10 A G 1: 131,024,203 M158V probably benign Het
Jmjd1c G A 10: 67,233,414 M1656I probably damaging Het
Kit A T 5: 75,609,394 K155N probably benign Het
Lmtk3 C A 7: 45,786,862 A114E probably damaging Het
Lztr1 A G 16: 17,512,129 probably benign Het
Mras A G 9: 99,411,485 F34S probably damaging Het
Myo1c A G 11: 75,662,635 T516A probably damaging Het
Nme8 A C 13: 19,677,868 V197G possibly damaging Het
Olfr1089 T C 2: 86,732,805 D269G probably benign Het
Olfr1339 T A 4: 118,735,371 Y281N probably damaging Het
Pcnx2 C T 8: 125,761,523 probably null Het
Plekhg4 T C 8: 105,380,750 F892S probably damaging Het
Prmt3 T A 7: 49,780,334 F62I probably damaging Het
Ralgapa1 T C 12: 55,612,738 Y1999C probably damaging Het
Rims2 A T 15: 39,345,413 Q204L possibly damaging Het
Slc6a16 T G 7: 45,261,108 H352Q probably benign Het
Snx9 T A 17: 5,891,809 C70* probably null Het
Srprb A G 9: 103,197,601 I114T probably damaging Het
Tas2r119 A T 15: 32,177,968 I227F probably damaging Het
Tg A T 15: 66,838,057 Y163F probably benign Het
Tm2d2 A G 8: 25,022,768 T211A probably damaging Het
Tmem132b A G 5: 125,622,646 S83G probably benign Het
Trav9-4 T C 14: 53,676,429 S47P probably benign Het
Vmn2r8 T A 5: 108,802,459 H174L probably damaging Het
Xrcc1 A G 7: 24,559,845 D85G possibly damaging Het
Zfp106 C G 2: 120,531,957 A34P probably damaging Het
Zfp608 A T 18: 54,898,272 N865K probably damaging Het
Zscan5b A G 7: 6,230,519 D114G probably benign Het
Other mutations in Pcdhb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Pcdhb9 APN 18 37403279 missense possibly damaging 0.59
IGL01557:Pcdhb9 APN 18 37403047 missense probably damaging 1.00
IGL01716:Pcdhb9 APN 18 37403175 missense probably damaging 0.99
IGL01954:Pcdhb9 APN 18 37401741 missense probably damaging 1.00
IGL02063:Pcdhb9 APN 18 37401757 missense probably benign 0.21
IGL03057:Pcdhb9 APN 18 37401277 missense probably benign 0.00
R0140:Pcdhb9 UTSW 18 37402961 missense possibly damaging 0.89
R0180:Pcdhb9 UTSW 18 37402254 missense probably damaging 1.00
R0349:Pcdhb9 UTSW 18 37402579 missense probably damaging 0.99
R0616:Pcdhb9 UTSW 18 37401975 nonsense probably null
R0669:Pcdhb9 UTSW 18 37402255 missense probably damaging 1.00
R1256:Pcdhb9 UTSW 18 37403116 missense possibly damaging 0.94
R1642:Pcdhb9 UTSW 18 37400934 intron probably benign
R1678:Pcdhb9 UTSW 18 37401629 missense probably damaging 1.00
R1711:Pcdhb9 UTSW 18 37403327 nonsense probably null
R1762:Pcdhb9 UTSW 18 37403083 missense probably benign 0.00
R1823:Pcdhb9 UTSW 18 37402818 missense probably benign 0.14
R1868:Pcdhb9 UTSW 18 37402084 missense probably damaging 1.00
R1959:Pcdhb9 UTSW 18 37403316 missense probably damaging 1.00
R2446:Pcdhb9 UTSW 18 37403287 missense probably damaging 0.99
R2889:Pcdhb9 UTSW 18 37403223 missense probably benign 0.06
R2890:Pcdhb9 UTSW 18 37403326 missense probably benign 0.23
R3196:Pcdhb9 UTSW 18 37401610 missense probably benign 0.02
R3725:Pcdhb9 UTSW 18 37401601 missense possibly damaging 0.95
R3726:Pcdhb9 UTSW 18 37401601 missense possibly damaging 0.95
R4179:Pcdhb9 UTSW 18 37401115 missense probably benign 0.17
R4326:Pcdhb9 UTSW 18 37401822 missense probably benign 0.04
R4326:Pcdhb9 UTSW 18 37401823 missense probably benign 0.15
R4327:Pcdhb9 UTSW 18 37401822 missense probably benign 0.04
R4327:Pcdhb9 UTSW 18 37401823 missense probably benign 0.15
R4329:Pcdhb9 UTSW 18 37401822 missense probably benign 0.04
R4329:Pcdhb9 UTSW 18 37401823 missense probably benign 0.15
R4626:Pcdhb9 UTSW 18 37402249 missense probably benign 0.01
R4738:Pcdhb9 UTSW 18 37403415 missense probably benign 0.33
R4888:Pcdhb9 UTSW 18 37403233 missense probably benign 0.22
R5140:Pcdhb9 UTSW 18 37401133 missense probably benign 0.00
R5186:Pcdhb9 UTSW 18 37401232 missense probably damaging 1.00
R5502:Pcdhb9 UTSW 18 37401603 missense possibly damaging 0.95
R5586:Pcdhb9 UTSW 18 37401114 missense probably benign
R5601:Pcdhb9 UTSW 18 37402206 missense probably damaging 1.00
R5827:Pcdhb9 UTSW 18 37401958 missense possibly damaging 0.72
R5829:Pcdhb9 UTSW 18 37401889 missense probably damaging 0.97
R5837:Pcdhb9 UTSW 18 37402798 missense probably damaging 1.00
R6147:Pcdhb9 UTSW 18 37402441 missense possibly damaging 0.95
R6228:Pcdhb9 UTSW 18 37402062 missense probably benign 0.00
R6245:Pcdhb9 UTSW 18 37403154 missense probably damaging 1.00
R6304:Pcdhb9 UTSW 18 37401367 missense probably damaging 0.99
R6542:Pcdhb9 UTSW 18 37401589 missense probably damaging 0.99
R6904:Pcdhb9 UTSW 18 37401917 missense probably benign 0.01
R7058:Pcdhb9 UTSW 18 37403281 missense probably benign 0.35
R7159:Pcdhb9 UTSW 18 37401492 missense possibly damaging 0.89
R7258:Pcdhb9 UTSW 18 37402114 missense probably damaging 1.00
R7800:Pcdhb9 UTSW 18 37401549 missense probably benign 0.01
R8027:Pcdhb9 UTSW 18 37403016 missense possibly damaging 0.81
R8141:Pcdhb9 UTSW 18 37402308 missense probably damaging 1.00
R8157:Pcdhb9 UTSW 18 37403155 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTGGCTCCTTTGTAGCC -3'
(R):5'- CTGACTGTGTATTGTTGAAGCC -3'

Sequencing Primer
(F):5'- TGGCCAAGGATCTGGGTC -3'
(R):5'- ACTGTGTATTGTTGAAGCCCATTGC -3'
Posted On2016-11-08