Mutagenetix > Incidental Mutation

Incidental Mutation 'R5625:Cxcr2'

441765

Institutional Source

Beutler Lab

Gene Symbol

Cxcr2

Ensembl Gene

ENSMUSG00000026180

Gene Name

C-X-C motif chemokine receptor 2

Synonyms

CD128, IL-8Rh, Gpcr16, IL-8rb, Il8rb, IL8RA, Cmkar2

MMRRC Submission

043164-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5625 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74193153-74200405 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 74197991 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 162 (K162*)

Ref Sequence

ENSEMBL: ENSMUSP00000102512 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027372] [ENSMUST00000106899]

AlphaFold

P35343

Predicted Effect

probably null
Transcript: ENSMUST00000027372
AA Change: K162*

SMART Domains

Protein: ENSMUSP00000027372
Gene: ENSMUSG00000026180
AA Change: K162*

Domain	Start	End	E-Value	Type
Pfam:7tm_1	64	313	1.2e-53	PFAM
low complexity region	346	358	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106899
AA Change: K162*

SMART Domains

Protein: ENSMUSP00000102512
Gene: ENSMUSG00000026180
AA Change: K162*

Domain	Start	End	E-Value	Type
Pfam:7tm_1	64	313	1.1e-58	PFAM
low complexity region	346	358	N/A	INTRINSIC

Meta Mutation Damage Score

0.9754

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein-coupled receptor family. This protein is a receptor for interleukin 8 (IL8). It binds to IL8 with high affinity, and transduces the signal through a G-protein activated second messenger system. This receptor also binds to chemokine (C-X-C motif) ligand 1 (CXCL1/MGSA), a protein with melanoma growth stimulating activity, and has been shown to be a major component required for serum-dependent melanoma cell growth. This receptor mediates neutrophil migration to sites of inflammation. The angiogenic effects of IL8 in intestinal microvascular endothelial cells are found to be mediated by this receptor. Knockout studies in mice suggested that this receptor controls the positioning of oligodendrocyte precursors in developing spinal cord by arresting their migration. This gene, IL8RA, a gene encoding another high affinity IL8 receptor, as well as IL8RBP, a pseudogene of IL8RB, form a gene cluster in a region mapped to chromosome 2q33-q36. Alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but exhibit splenomegaly, lymphadenopathy, and increased susceptibility to various pathogens due to impaired neutrophil recruitment and decreased pathogen clearance during innate immune responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg4	T	G	9: 44,189,333 (GRCm39)	D388A	probably benign	Het
Ampd3	A	C	7: 110,401,730 (GRCm39)	E408A	probably damaging	Het
Bmp1	G	T	14: 70,723,606 (GRCm39)	N743K	probably benign	Het
Brsk1	A	G	7: 4,709,399 (GRCm39)	K398E	probably damaging	Het
Ccdc157	A	T	11: 4,101,888 (GRCm39)	M11K	probably damaging	Het
Cep295	A	C	9: 15,252,187 (GRCm39)	M394R	probably damaging	Het
Cfap44	G	T	16: 44,280,710 (GRCm39)		probably null	Het
Col13a1	C	T	10: 61,679,388 (GRCm39)	G713R	unknown	Het
Cyp3a44	C	T	5: 145,716,376 (GRCm39)	D405N	possibly damaging	Het
Exo1	G	T	1: 175,721,380 (GRCm39)	D340Y	possibly damaging	Het
Farp2	T	G	1: 93,456,470 (GRCm39)	L51R	probably damaging	Het
Fat4	A	T	3: 38,943,083 (GRCm39)	I659F	possibly damaging	Het
Gbp2b	T	A	3: 142,304,806 (GRCm39)	W81R	probably damaging	Het
Gipc2	C	T	3: 151,871,541 (GRCm39)		probably benign	Het
Gm10941	G	T	10: 77,094,670 (GRCm39)		probably benign	Het
Gm1988	A	T	7: 38,823,229 (GRCm39)		noncoding transcript	Het
Hapln3	G	T	7: 78,767,006 (GRCm39)		probably null	Het
Ifi213	A	G	1: 173,396,629 (GRCm39)	S482P	possibly damaging	Het
Insc	A	G	7: 114,428,302 (GRCm39)	T92A	probably damaging	Het
Lrrn1	T	A	6: 107,544,315 (GRCm39)	C38S	probably damaging	Het
Mycbpap	T	C	11: 94,396,519 (GRCm39)	E107G	probably damaging	Het
Neb	A	T	2: 52,067,547 (GRCm39)	L5848*	probably null	Het
Nrg3	A	T	14: 38,092,950 (GRCm39)	M545K	probably damaging	Het
Nudt3	A	G	17: 27,802,202 (GRCm39)	L28P	probably damaging	Het
Or8g35	T	A	9: 39,381,099 (GRCm39)	M308L	probably benign	Het
Otop1	A	T	5: 38,460,104 (GRCm39)	Y557F	probably damaging	Het
Pcare	T	A	17: 72,058,321 (GRCm39)	D452V	probably damaging	Het
Pdgfra	G	A	5: 75,349,998 (GRCm39)		probably null	Het
Pi4kb	A	G	3: 94,891,988 (GRCm39)	M223V	probably benign	Het
Piezo1	T	C	8: 123,209,699 (GRCm39)	T2335A	probably benign	Het
Ppp6c	A	G	2: 39,087,453 (GRCm39)	V251A	probably benign	Het
Prkg1	C	T	19: 31,742,162 (GRCm39)	E21K	possibly damaging	Het
Ptpru	T	C	4: 131,530,691 (GRCm39)	E521G	probably null	Het
Rasl10b	G	T	11: 83,309,640 (GRCm39)	R199L	probably damaging	Het
Rhbdf2	G	A	11: 116,496,203 (GRCm39)	R111C	probably damaging	Het
Sec23ip	G	T	7: 128,346,707 (GRCm39)		probably benign	Het
Sptbn5	A	T	2: 119,910,273 (GRCm39)		noncoding transcript	Het
Srsf11	C	T	3: 157,728,981 (GRCm39)		probably benign	Het
Syne2	T	C	12: 76,141,886 (GRCm39)	S6141P	probably benign	Het
Szt2	A	G	4: 118,230,414 (GRCm39)	V2653A	unknown	Het
Tex46	T	C	4: 136,337,925 (GRCm39)	F39S	probably damaging	Het
Tmem50a	AACCA	AA	4: 134,625,778 (GRCm39)		probably benign	Het
Tmem62	G	T	2: 120,820,874 (GRCm39)	W180L	probably damaging	Het
Tnxb	G	A	17: 34,904,185 (GRCm39)	A1232T	probably benign	Het
Tubgcp3	T	C	8: 12,674,888 (GRCm39)	H744R	possibly damaging	Het
Uggt2	A	G	14: 119,315,136 (GRCm39)	I311T	probably damaging	Het
Usp8	C	T	2: 126,584,197 (GRCm39)	R469C	probably damaging	Het
Vmn1r19	T	C	6: 57,382,281 (GRCm39)	L278S	probably damaging	Het
Vmn2r129	A	T	4: 156,686,505 (GRCm39)		noncoding transcript	Het
Vmn2r59	A	T	7: 41,695,884 (GRCm39)	I176N	probably benign	Het
Wdr93	A	G	7: 79,420,766 (GRCm39)	T376A	probably benign	Het
Zfp575	G	A	7: 24,285,077 (GRCm39)	A188V	possibly damaging	Het

Other mutations in Cxcr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02128:Cxcr2	APN	1	74,198,153 (GRCm39)	missense	probably benign	0.07
IGL03384:Cxcr2	APN	1	74,197,950 (GRCm39)	missense	probably damaging	0.98
copperas	UTSW	1	74,197,619 (GRCm39)	missense	probably damaging	0.98
R0780:Cxcr2	UTSW	1	74,198,334 (GRCm39)	missense	probably damaging	0.97
R1178:Cxcr2	UTSW	1	74,197,527 (GRCm39)	missense	probably benign	0.04
R1180:Cxcr2	UTSW	1	74,197,527 (GRCm39)	missense	probably benign	0.04
R1448:Cxcr2	UTSW	1	74,197,527 (GRCm39)	missense	probably benign	0.04
R1535:Cxcr2	UTSW	1	74,198,217 (GRCm39)	missense	probably damaging	1.00
R1851:Cxcr2	UTSW	1	74,198,438 (GRCm39)	missense	probably benign	0.01
R1852:Cxcr2	UTSW	1	74,198,438 (GRCm39)	missense	probably benign	0.01
R2897:Cxcr2	UTSW	1	74,198,130 (GRCm39)	missense	probably benign	0.04
R2898:Cxcr2	UTSW	1	74,198,130 (GRCm39)	missense	probably benign	0.04
R4430:Cxcr2	UTSW	1	74,198,004 (GRCm39)	missense	probably benign	0.01
R4542:Cxcr2	UTSW	1	74,197,688 (GRCm39)	missense	probably benign	0.02
R5996:Cxcr2	UTSW	1	74,197,619 (GRCm39)	missense	probably damaging	0.98
R6737:Cxcr2	UTSW	1	74,197,790 (GRCm39)	missense	probably benign
R7206:Cxcr2	UTSW	1	74,198,213 (GRCm39)	missense	possibly damaging	0.69
R7577:Cxcr2	UTSW	1	74,198,074 (GRCm39)	missense	probably benign	0.00
R7717:Cxcr2	UTSW	1	74,197,998 (GRCm39)	missense	probably benign	0.05
R7873:Cxcr2	UTSW	1	74,198,166 (GRCm39)	missense	probably benign	0.14
R8300:Cxcr2	UTSW	1	74,198,333 (GRCm39)	missense	probably benign	0.01
R9224:Cxcr2	UTSW	1	74,197,756 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTCTGGGCTGCATCTAAAG -3'
(R):5'- AGTGTGAACCCGTAGCAGAAC -3'

Sequencing Primer
(F):5'- GTCTGGGCTGCATCTAAAGTAAATG -3'
(R):5'- CCCGTAGCAGAACAGCATGATG -3'

Posted On

2016-11-08