Incidental Mutation 'R5625:Ifi213'
ID441767
Institutional Source Beutler Lab
Gene Symbol Ifi213
Ensembl Gene ENSMUSG00000073491
Gene Nameinterferon activated gene 213
SynonymsE030037K03Rik, Pydc4, Pyr-A
MMRRC Submission 043164-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5625 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173566283-173599274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 173569063 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 482 (S482P)
Ref Sequence ENSEMBL: ENSMUSP00000117222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000150649]
Predicted Effect possibly damaging
Transcript: ENSMUST00000150649
AA Change: S482P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117222
Gene: ENSMUSG00000073491
AA Change: S482P

DomainStartEndE-ValueType
PYRIN 10 88 3.71e-20 SMART
low complexity region 101 112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179648
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T G 9: 44,278,036 D388A probably benign Het
Ampd3 A C 7: 110,802,523 E408A probably damaging Het
BC027072 T A 17: 71,751,326 D452V probably damaging Het
Bmp1 G T 14: 70,486,166 N743K probably benign Het
Brsk1 A G 7: 4,706,400 K398E probably damaging Het
Ccdc157 A T 11: 4,151,888 M11K probably damaging Het
Cep295 A C 9: 15,340,891 M394R probably damaging Het
Cfap44 G T 16: 44,460,347 probably null Het
Col13a1 C T 10: 61,843,609 G713R unknown Het
Cxcr2 A T 1: 74,158,832 K162* probably null Het
Cyp3a44 C T 5: 145,779,566 D405N possibly damaging Het
Exo1 G T 1: 175,893,814 D340Y possibly damaging Het
Farp2 T G 1: 93,528,748 L51R probably damaging Het
Fat4 A T 3: 38,888,934 I659F possibly damaging Het
Gbp2b T A 3: 142,599,045 W81R probably damaging Het
Gipc2 C T 3: 152,165,904 probably benign Het
Gm10941 G T 10: 77,258,836 probably benign Het
Gm1988 A T 7: 39,173,805 noncoding transcript Het
Hapln3 G T 7: 79,117,258 probably null Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Lrrn1 T A 6: 107,567,354 C38S probably damaging Het
Mycbpap T C 11: 94,505,693 E107G probably damaging Het
Neb A T 2: 52,177,535 L5848* probably null Het
Nrg3 A T 14: 38,370,993 M545K probably damaging Het
Nudt3 A G 17: 27,583,228 L28P probably damaging Het
Olfr955 T A 9: 39,469,803 M308L probably benign Het
Otop1 A T 5: 38,302,761 Y557F probably damaging Het
Pdgfra G A 5: 75,189,337 probably null Het
Pi4kb A G 3: 94,984,677 M223V probably benign Het
Piezo1 T C 8: 122,482,960 T2335A probably benign Het
Ppp6c A G 2: 39,197,441 V251A probably benign Het
Prkg1 C T 19: 31,764,762 E21K possibly damaging Het
Ptpru T C 4: 131,803,380 E521G probably null Het
Rasl10b G T 11: 83,418,814 R199L probably damaging Het
Rhbdf2 G A 11: 116,605,377 R111C probably damaging Het
Sec23ip G T 7: 128,744,983 probably benign Het
Sptbn5 A T 2: 120,079,792 noncoding transcript Het
Srsf11 C T 3: 158,023,344 probably benign Het
Syne2 T C 12: 76,095,112 S6141P probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tex46 T C 4: 136,610,614 F39S probably damaging Het
Tmem50a AACCA AA 4: 134,898,467 probably benign Het
Tmem62 G T 2: 120,990,393 W180L probably damaging Het
Tnxb G A 17: 34,685,211 A1232T probably benign Het
Tubgcp3 T C 8: 12,624,888 H744R possibly damaging Het
Uggt2 A G 14: 119,077,724 I311T probably damaging Het
Usp8 C T 2: 126,742,277 R469C probably damaging Het
Vmn1r19 T C 6: 57,405,296 L278S probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Vmn2r-ps159 A T 4: 156,334,210 noncoding transcript Het
Wdr93 A G 7: 79,771,018 T376A probably benign Het
Zfp575 G A 7: 24,585,652 A188V possibly damaging Het
Other mutations in Ifi213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Ifi213 APN 1 173594053 splice site probably benign
IGL00908:Ifi213 APN 1 173595083 missense probably damaging 1.00
IGL00964:Ifi213 APN 1 173593952 missense possibly damaging 0.91
IGL02217:Ifi213 APN 1 173595032 missense possibly damaging 0.91
R0709:Ifi213 UTSW 1 173589800 missense possibly damaging 0.70
R1518:Ifi213 UTSW 1 173589663 missense probably damaging 0.99
R1559:Ifi213 UTSW 1 173567218 missense probably benign 0.18
R1822:Ifi213 UTSW 1 173589842 missense probably damaging 0.99
R1839:Ifi213 UTSW 1 173589600 missense probably damaging 0.98
R1989:Ifi213 UTSW 1 173568808 critical splice donor site probably null
R2108:Ifi213 UTSW 1 173569102 critical splice acceptor site probably null
R2696:Ifi213 UTSW 1 173590024 missense probably benign
R3890:Ifi213 UTSW 1 173567256 missense probably benign 0.33
R4544:Ifi213 UTSW 1 173582127 splice site probably null
R4611:Ifi213 UTSW 1 173589914 missense possibly damaging 0.91
R4689:Ifi213 UTSW 1 173590420 missense possibly damaging 0.92
R4710:Ifi213 UTSW 1 173567172 utr 3 prime probably benign
R5126:Ifi213 UTSW 1 173590015 missense possibly damaging 0.85
R5472:Ifi213 UTSW 1 173567272 splice site probably null
R5789:Ifi213 UTSW 1 173568794 splice site probably benign
R5898:Ifi213 UTSW 1 173568979 missense probably benign 0.01
R6025:Ifi213 UTSW 1 173595234 missense probably damaging 0.99
R6149:Ifi213 UTSW 1 173594015 missense probably benign 0.18
R6348:Ifi213 UTSW 1 173590282 missense possibly damaging 0.46
R6564:Ifi213 UTSW 1 173595296 start codon destroyed probably null 0.06
R7254:Ifi213 UTSW 1 173593963 missense probably damaging 0.98
R7292:Ifi213 UTSW 1 173595125 missense probably damaging 0.99
R7752:Ifi213 UTSW 1 173567218 missense probably benign 0.18
R7901:Ifi213 UTSW 1 173567218 missense probably benign 0.18
R8100:Ifi213 UTSW 1 173595182 missense probably damaging 1.00
R8352:Ifi213 UTSW 1 173595269 missense possibly damaging 0.92
R8425:Ifi213 UTSW 1 173589860 missense probably benign
R8452:Ifi213 UTSW 1 173595269 missense possibly damaging 0.92
RF010:Ifi213 UTSW 1 173582153 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTGCTTCACGAGTCAGCTT -3'
(R):5'- AGACAATGGACAGGCCTATACTTC -3'

Sequencing Primer
(F):5'- CACGAGTCAGCTTCTTTAGTTG -3'
(R):5'- TGGACAGGCCTATACTTCTAAAGC -3'
Posted On2016-11-08