Incidental Mutation 'R5625:Exo1'
ID441768
Institutional Source Beutler Lab
Gene Symbol Exo1
Ensembl Gene ENSMUSG00000039748
Gene Nameexonuclease 1
Synonyms5730442G03Rik, Msa
MMRRC Submission 043164-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R5625 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location175880581-175913489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 175893814 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 340 (D340Y)
Ref Sequence ENSEMBL: ENSMUSP00000039376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039725] [ENSMUST00000193822] [ENSMUST00000193858] [ENSMUST00000194306]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039725
AA Change: D340Y

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039376
Gene: ENSMUSG00000039748
AA Change: D340Y

DomainStartEndE-ValueType
XPGN 1 99 6.24e-38 SMART
XPGI 138 208 4.56e-31 SMART
HhH2 212 245 2.28e-8 SMART
Blast:XPGI 252 288 4e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000191680
Predicted Effect probably benign
Transcript: ENSMUST00000193822
SMART Domains Protein: ENSMUSP00000141624
Gene: ENSMUSG00000039748

DomainStartEndE-ValueType
XPGN 1 83 3.5e-11 SMART
XPGI 98 168 1.4e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193858
SMART Domains Protein: ENSMUSP00000141568
Gene: ENSMUSG00000039748

DomainStartEndE-ValueType
XPGN 1 83 3.5e-11 SMART
XPGI 98 168 1.4e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194306
SMART Domains Protein: ENSMUSP00000141770
Gene: ENSMUSG00000039748

DomainStartEndE-ValueType
XPGN 1 99 2e-40 SMART
XPGI 138 208 1.4e-33 SMART
Meta Mutation Damage Score 0.1636 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 5' to 3' exonuclease activity as well as an RNase H activity. It is similar to the Saccharomyces cerevisiae protein Exo1 which interacts with Msh2 and which is involved in mismatch repair and recombination. Alternative splicing of this gene results in three transcript variants encoding two different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced life span, lymphoma development, and male/female sterilty due to defective meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T G 9: 44,278,036 D388A probably benign Het
Ampd3 A C 7: 110,802,523 E408A probably damaging Het
BC027072 T A 17: 71,751,326 D452V probably damaging Het
Bmp1 G T 14: 70,486,166 N743K probably benign Het
Brsk1 A G 7: 4,706,400 K398E probably damaging Het
Ccdc157 A T 11: 4,151,888 M11K probably damaging Het
Cep295 A C 9: 15,340,891 M394R probably damaging Het
Cfap44 G T 16: 44,460,347 probably null Het
Col13a1 C T 10: 61,843,609 G713R unknown Het
Cxcr2 A T 1: 74,158,832 K162* probably null Het
Cyp3a44 C T 5: 145,779,566 D405N possibly damaging Het
Farp2 T G 1: 93,528,748 L51R probably damaging Het
Fat4 A T 3: 38,888,934 I659F possibly damaging Het
Gbp2b T A 3: 142,599,045 W81R probably damaging Het
Gipc2 C T 3: 152,165,904 probably benign Het
Gm10941 G T 10: 77,258,836 probably benign Het
Gm1988 A T 7: 39,173,805 noncoding transcript Het
Hapln3 G T 7: 79,117,258 probably null Het
Ifi213 A G 1: 173,569,063 S482P possibly damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Lrrn1 T A 6: 107,567,354 C38S probably damaging Het
Mycbpap T C 11: 94,505,693 E107G probably damaging Het
Neb A T 2: 52,177,535 L5848* probably null Het
Nrg3 A T 14: 38,370,993 M545K probably damaging Het
Nudt3 A G 17: 27,583,228 L28P probably damaging Het
Olfr955 T A 9: 39,469,803 M308L probably benign Het
Otop1 A T 5: 38,302,761 Y557F probably damaging Het
Pdgfra G A 5: 75,189,337 probably null Het
Pi4kb A G 3: 94,984,677 M223V probably benign Het
Piezo1 T C 8: 122,482,960 T2335A probably benign Het
Ppp6c A G 2: 39,197,441 V251A probably benign Het
Prkg1 C T 19: 31,764,762 E21K possibly damaging Het
Ptpru T C 4: 131,803,380 E521G probably null Het
Rasl10b G T 11: 83,418,814 R199L probably damaging Het
Rhbdf2 G A 11: 116,605,377 R111C probably damaging Het
Sec23ip G T 7: 128,744,983 probably benign Het
Sptbn5 A T 2: 120,079,792 noncoding transcript Het
Srsf11 C T 3: 158,023,344 probably benign Het
Syne2 T C 12: 76,095,112 S6141P probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tex46 T C 4: 136,610,614 F39S probably damaging Het
Tmem50a AACCA AA 4: 134,898,467 probably benign Het
Tmem62 G T 2: 120,990,393 W180L probably damaging Het
Tnxb G A 17: 34,685,211 A1232T probably benign Het
Tubgcp3 T C 8: 12,624,888 H744R possibly damaging Het
Uggt2 A G 14: 119,077,724 I311T probably damaging Het
Usp8 C T 2: 126,742,277 R469C probably damaging Het
Vmn1r19 T C 6: 57,405,296 L278S probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Vmn2r-ps159 A T 4: 156,334,210 noncoding transcript Het
Wdr93 A G 7: 79,771,018 T376A probably benign Het
Zfp575 G A 7: 24,585,652 A188V possibly damaging Het
Other mutations in Exo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Exo1 APN 1 175896237 missense probably benign 0.00
IGL01116:Exo1 APN 1 175901397 missense possibly damaging 0.76
IGL01766:Exo1 APN 1 175892021 missense possibly damaging 0.67
IGL02117:Exo1 APN 1 175893743 missense possibly damaging 0.60
IGL02979:Exo1 APN 1 175899407 missense probably damaging 1.00
IGL03026:Exo1 APN 1 175908437 makesense probably null
IGL03109:Exo1 APN 1 175899560 missense probably damaging 1.00
IGL03208:Exo1 APN 1 175896245 missense probably benign 0.01
IGL03342:Exo1 APN 1 175892127 missense probably benign 0.09
IGL03147:Exo1 UTSW 1 175888788 missense probably damaging 1.00
R0194:Exo1 UTSW 1 175892030 missense probably damaging 1.00
R0427:Exo1 UTSW 1 175905953 missense probably damaging 0.96
R0520:Exo1 UTSW 1 175899465 missense probably benign 0.00
R1382:Exo1 UTSW 1 175893796 missense probably damaging 0.98
R1618:Exo1 UTSW 1 175901386 missense probably benign 0.00
R1666:Exo1 UTSW 1 175908486 missense possibly damaging 0.81
R2007:Exo1 UTSW 1 175908530 missense probably damaging 1.00
R2177:Exo1 UTSW 1 175882890 splice site probably null
R2224:Exo1 UTSW 1 175886688 critical splice acceptor site probably null
R2305:Exo1 UTSW 1 175888761 missense probably damaging 1.00
R2509:Exo1 UTSW 1 175905833 missense probably damaging 1.00
R3405:Exo1 UTSW 1 175905970 missense possibly damaging 0.89
R3406:Exo1 UTSW 1 175905970 missense possibly damaging 0.89
R3711:Exo1 UTSW 1 175893829 missense probably benign
R3767:Exo1 UTSW 1 175886746 missense probably damaging 1.00
R3787:Exo1 UTSW 1 175899469 missense probably benign
R3853:Exo1 UTSW 1 175892988 missense probably benign 0.01
R5304:Exo1 UTSW 1 175892976 missense probably damaging 1.00
R5869:Exo1 UTSW 1 175901283 missense possibly damaging 0.59
R7013:Exo1 UTSW 1 175893772 missense probably damaging 1.00
R7238:Exo1 UTSW 1 175888847 missense probably damaging 1.00
R7514:Exo1 UTSW 1 175906666 splice site probably null
R7522:Exo1 UTSW 1 175901304 missense probably benign 0.08
R7895:Exo1 UTSW 1 175900996 missense probably benign 0.06
R8218:Exo1 UTSW 1 175900914 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGGGTCTATGTACATGATGAACC -3'
(R):5'- TGCCAAGTGCCAAAGTCTG -3'

Sequencing Primer
(F):5'- CTATGTACATGATGAACCTTGAAGG -3'
(R):5'- GGCCATCTTGGTCTACACAATGAG -3'
Posted On2016-11-08