Incidental Mutation 'R5625:Usp8'
ID441775
Institutional Source Beutler Lab
Gene Symbol Usp8
Ensembl Gene ENSMUSG00000027363
Gene Nameubiquitin specific peptidase 8
SynonymsUbpy
MMRRC Submission 043164-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5625 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location126707328-126759297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 126742277 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 469 (R469C)
Ref Sequence ENSEMBL: ENSMUSP00000106046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028841] [ENSMUST00000110416] [ENSMUST00000136319]
Predicted Effect probably damaging
Transcript: ENSMUST00000028841
AA Change: R458C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028841
Gene: ENSMUSG00000027363
AA Change: R458C

DomainStartEndE-ValueType
Pfam:USP8_dimer 6 116 2.3e-37 PFAM
low complexity region 119 140 N/A INTRINSIC
RHOD 185 310 3.69e-7 SMART
low complexity region 378 393 N/A INTRINSIC
coiled coil region 467 501 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
Pfam:UCH 738 1068 4e-88 PFAM
Pfam:UCH_1 739 1053 1.9e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110416
AA Change: R469C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106046
Gene: ENSMUSG00000027363
AA Change: R469C

DomainStartEndE-ValueType
Pfam:USP8_dimer 6 127 2.5e-36 PFAM
low complexity region 130 151 N/A INTRINSIC
RHOD 196 321 3.69e-7 SMART
low complexity region 389 404 N/A INTRINSIC
coiled coil region 478 512 N/A INTRINSIC
low complexity region 653 668 N/A INTRINSIC
Pfam:UCH 749 1079 1.3e-82 PFAM
Pfam:UCH_1 750 1064 3.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136319
SMART Domains Protein: ENSMUSP00000121578
Gene: ENSMUSG00000027364

DomainStartEndE-ValueType
Pfam:UCH 1 268 1.9e-39 PFAM
Pfam:UCH_1 1 269 1.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138859
Meta Mutation Damage Score 0.1657 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the ubiquitin-specific processing protease family of proteins. The encoded protein is thought to regulate the morphology of the endosome by ubiquitination of proteins on this organelle and is involved in cargo sorting and membrane trafficking at the early endosome stage. This protein is required for the cell to enter the S phase of the cell cycle and also functions as a positive regulator in the Hedgehog signaling pathway in development. Pseudogenes of this gene are present on chromosomes 2 and 6. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele appear severely growth retarded and disorganized at E9.5 and die in utero due to ventral-folding defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T G 9: 44,278,036 D388A probably benign Het
Ampd3 A C 7: 110,802,523 E408A probably damaging Het
BC027072 T A 17: 71,751,326 D452V probably damaging Het
Bmp1 G T 14: 70,486,166 N743K probably benign Het
Brsk1 A G 7: 4,706,400 K398E probably damaging Het
Ccdc157 A T 11: 4,151,888 M11K probably damaging Het
Cep295 A C 9: 15,340,891 M394R probably damaging Het
Cfap44 G T 16: 44,460,347 probably null Het
Col13a1 C T 10: 61,843,609 G713R unknown Het
Cxcr2 A T 1: 74,158,832 K162* probably null Het
Cyp3a44 C T 5: 145,779,566 D405N possibly damaging Het
Exo1 G T 1: 175,893,814 D340Y possibly damaging Het
Farp2 T G 1: 93,528,748 L51R probably damaging Het
Fat4 A T 3: 38,888,934 I659F possibly damaging Het
Gbp2b T A 3: 142,599,045 W81R probably damaging Het
Gipc2 C T 3: 152,165,904 probably benign Het
Gm10941 G T 10: 77,258,836 probably benign Het
Gm1988 A T 7: 39,173,805 noncoding transcript Het
Hapln3 G T 7: 79,117,258 probably null Het
Ifi213 A G 1: 173,569,063 S482P possibly damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Lrrn1 T A 6: 107,567,354 C38S probably damaging Het
Mycbpap T C 11: 94,505,693 E107G probably damaging Het
Neb A T 2: 52,177,535 L5848* probably null Het
Nrg3 A T 14: 38,370,993 M545K probably damaging Het
Nudt3 A G 17: 27,583,228 L28P probably damaging Het
Olfr955 T A 9: 39,469,803 M308L probably benign Het
Otop1 A T 5: 38,302,761 Y557F probably damaging Het
Pdgfra G A 5: 75,189,337 probably null Het
Pi4kb A G 3: 94,984,677 M223V probably benign Het
Piezo1 T C 8: 122,482,960 T2335A probably benign Het
Ppp6c A G 2: 39,197,441 V251A probably benign Het
Prkg1 C T 19: 31,764,762 E21K possibly damaging Het
Ptpru T C 4: 131,803,380 E521G probably null Het
Rasl10b G T 11: 83,418,814 R199L probably damaging Het
Rhbdf2 G A 11: 116,605,377 R111C probably damaging Het
Sec23ip G T 7: 128,744,983 probably benign Het
Sptbn5 A T 2: 120,079,792 noncoding transcript Het
Srsf11 C T 3: 158,023,344 probably benign Het
Syne2 T C 12: 76,095,112 S6141P probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tex46 T C 4: 136,610,614 F39S probably damaging Het
Tmem50a AACCA AA 4: 134,898,467 probably benign Het
Tmem62 G T 2: 120,990,393 W180L probably damaging Het
Tnxb G A 17: 34,685,211 A1232T probably benign Het
Tubgcp3 T C 8: 12,624,888 H744R possibly damaging Het
Uggt2 A G 14: 119,077,724 I311T probably damaging Het
Vmn1r19 T C 6: 57,405,296 L278S probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Vmn2r-ps159 A T 4: 156,334,210 noncoding transcript Het
Wdr93 A G 7: 79,771,018 T376A probably benign Het
Zfp575 G A 7: 24,585,652 A188V possibly damaging Het
Other mutations in Usp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Usp8 APN 2 126758560 missense probably damaging 1.00
IGL00771:Usp8 APN 2 126725433 splice site probably null
IGL01073:Usp8 APN 2 126718114 missense probably damaging 0.96
IGL01722:Usp8 APN 2 126758152 missense probably damaging 1.00
IGL02100:Usp8 APN 2 126737854 intron probably benign
IGL02210:Usp8 APN 2 126718056 intron probably benign
IGL02516:Usp8 APN 2 126742174 missense probably benign 0.00
IGL02743:Usp8 APN 2 126734023 missense probably damaging 1.00
IGL02953:Usp8 APN 2 126737937 missense probably benign
satsuke UTSW 2 126751111 missense probably damaging 1.00
R0045:Usp8 UTSW 2 126742223 missense probably benign 0.03
R0048:Usp8 UTSW 2 126737889 missense probably damaging 0.96
R0048:Usp8 UTSW 2 126737889 missense probably damaging 0.96
R0143:Usp8 UTSW 2 126755089 intron probably benign
R0427:Usp8 UTSW 2 126718032 intron probably benign
R0440:Usp8 UTSW 2 126725390 missense probably benign 0.00
R0636:Usp8 UTSW 2 126720110 missense possibly damaging 0.87
R0828:Usp8 UTSW 2 126742114 intron probably benign
R1468:Usp8 UTSW 2 126754927 missense probably damaging 1.00
R1468:Usp8 UTSW 2 126754927 missense probably damaging 1.00
R1782:Usp8 UTSW 2 126720051 missense probably damaging 1.00
R1860:Usp8 UTSW 2 126756040 missense probably damaging 1.00
R2127:Usp8 UTSW 2 126737575 intron probably null
R2259:Usp8 UTSW 2 126758568 missense probably benign 0.32
R2892:Usp8 UTSW 2 126758155 missense probably damaging 1.00
R2893:Usp8 UTSW 2 126758155 missense probably damaging 1.00
R3104:Usp8 UTSW 2 126758512 missense probably damaging 1.00
R4074:Usp8 UTSW 2 126752370 missense probably damaging 1.00
R4678:Usp8 UTSW 2 126725429 missense probably null 1.00
R4715:Usp8 UTSW 2 126729222 missense possibly damaging 0.80
R4832:Usp8 UTSW 2 126755038 missense probably damaging 1.00
R4914:Usp8 UTSW 2 126720140 nonsense probably null
R4915:Usp8 UTSW 2 126720140 nonsense probably null
R4918:Usp8 UTSW 2 126720140 nonsense probably null
R5262:Usp8 UTSW 2 126751111 missense probably damaging 1.00
R5667:Usp8 UTSW 2 126742425 missense probably benign 0.00
R5671:Usp8 UTSW 2 126742425 missense probably benign 0.00
R5984:Usp8 UTSW 2 126742481 missense probably benign 0.10
R6529:Usp8 UTSW 2 126725378 missense probably benign 0.01
R6551:Usp8 UTSW 2 126733182 intron probably benign
R6885:Usp8 UTSW 2 126752310 missense probably damaging 1.00
R7768:Usp8 UTSW 2 126751123 missense probably damaging 1.00
R8097:Usp8 UTSW 2 126754880 missense probably benign 0.44
R8130:Usp8 UTSW 2 126717998 intron probably benign
Z1177:Usp8 UTSW 2 126758431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTTGGGGCCAACTTAGC -3'
(R):5'- CGTCTGCTGAAAGCTCTCTG -3'

Sequencing Primer
(F):5'- CAGCACTAAAAGCACATTTGTTC -3'
(R):5'- GCTGAAAGCTCTCTGTCTTCCG -3'
Posted On2016-11-08