Incidental Mutation 'R5625:Pi4kb'
ID441777
Institutional Source Beutler Lab
Gene Symbol Pi4kb
Ensembl Gene ENSMUSG00000038861
Gene Namephosphatidylinositol 4-kinase beta
SynonymsESTM41, Pik4cb
MMRRC Submission 043164-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R5625 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location94974731-95006843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94984677 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 223 (M223V)
Ref Sequence ENSEMBL: ENSMUSP00000072134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072287] [ENSMUST00000107251] [ENSMUST00000125476] [ENSMUST00000138209] [ENSMUST00000167008]
Predicted Effect probably benign
Transcript: ENSMUST00000072287
AA Change: M223V

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000072134
Gene: ENSMUSG00000038861
AA Change: M223V

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 545 799 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107251
AA Change: M223V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000102872
Gene: ENSMUSG00000038861
AA Change: M223V

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 560 814 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125476
AA Change: M235V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000121965
Gene: ENSMUSG00000038861
AA Change: M235V

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
SCOP:d1e8xa1 152 243 5e-22 SMART
PI3Kc 572 826 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138209
Predicted Effect probably benign
Transcript: ENSMUST00000167008
SMART Domains Protein: ENSMUSP00000132150
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
PI3Kc 228 482 6.47e-105 SMART
Meta Mutation Damage Score 0.0698 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T G 9: 44,278,036 D388A probably benign Het
Ampd3 A C 7: 110,802,523 E408A probably damaging Het
BC027072 T A 17: 71,751,326 D452V probably damaging Het
Bmp1 G T 14: 70,486,166 N743K probably benign Het
Brsk1 A G 7: 4,706,400 K398E probably damaging Het
Ccdc157 A T 11: 4,151,888 M11K probably damaging Het
Cep295 A C 9: 15,340,891 M394R probably damaging Het
Cfap44 G T 16: 44,460,347 probably null Het
Col13a1 C T 10: 61,843,609 G713R unknown Het
Cxcr2 A T 1: 74,158,832 K162* probably null Het
Cyp3a44 C T 5: 145,779,566 D405N possibly damaging Het
Exo1 G T 1: 175,893,814 D340Y possibly damaging Het
Farp2 T G 1: 93,528,748 L51R probably damaging Het
Fat4 A T 3: 38,888,934 I659F possibly damaging Het
Gbp2b T A 3: 142,599,045 W81R probably damaging Het
Gipc2 C T 3: 152,165,904 probably benign Het
Gm10941 G T 10: 77,258,836 probably benign Het
Gm1988 A T 7: 39,173,805 noncoding transcript Het
Hapln3 G T 7: 79,117,258 probably null Het
Ifi213 A G 1: 173,569,063 S482P possibly damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Lrrn1 T A 6: 107,567,354 C38S probably damaging Het
Mycbpap T C 11: 94,505,693 E107G probably damaging Het
Neb A T 2: 52,177,535 L5848* probably null Het
Nrg3 A T 14: 38,370,993 M545K probably damaging Het
Nudt3 A G 17: 27,583,228 L28P probably damaging Het
Olfr955 T A 9: 39,469,803 M308L probably benign Het
Otop1 A T 5: 38,302,761 Y557F probably damaging Het
Pdgfra G A 5: 75,189,337 probably null Het
Piezo1 T C 8: 122,482,960 T2335A probably benign Het
Ppp6c A G 2: 39,197,441 V251A probably benign Het
Prkg1 C T 19: 31,764,762 E21K possibly damaging Het
Ptpru T C 4: 131,803,380 E521G probably null Het
Rasl10b G T 11: 83,418,814 R199L probably damaging Het
Rhbdf2 G A 11: 116,605,377 R111C probably damaging Het
Sec23ip G T 7: 128,744,983 probably benign Het
Sptbn5 A T 2: 120,079,792 noncoding transcript Het
Srsf11 C T 3: 158,023,344 probably benign Het
Syne2 T C 12: 76,095,112 S6141P probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tex46 T C 4: 136,610,614 F39S probably damaging Het
Tmem50a AACCA AA 4: 134,898,467 probably benign Het
Tmem62 G T 2: 120,990,393 W180L probably damaging Het
Tnxb G A 17: 34,685,211 A1232T probably benign Het
Tubgcp3 T C 8: 12,624,888 H744R possibly damaging Het
Uggt2 A G 14: 119,077,724 I311T probably damaging Het
Usp8 C T 2: 126,742,277 R469C probably damaging Het
Vmn1r19 T C 6: 57,405,296 L278S probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Vmn2r-ps159 A T 4: 156,334,210 noncoding transcript Het
Wdr93 A G 7: 79,771,018 T376A probably benign Het
Zfp575 G A 7: 24,585,652 A188V possibly damaging Het
Other mutations in Pi4kb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Pi4kb APN 3 95004263 missense probably damaging 1.00
IGL01559:Pi4kb APN 3 94984129 missense probably benign 0.00
IGL03003:Pi4kb APN 3 94984812 missense probably benign 0.00
IGL03087:Pi4kb APN 3 94984764 missense probably benign
R0014:Pi4kb UTSW 3 94998897 missense probably damaging 1.00
R0196:Pi4kb UTSW 3 94998950 missense probably damaging 1.00
R0387:Pi4kb UTSW 3 94984740 missense probably benign 0.42
R0394:Pi4kb UTSW 3 94996804 intron probably benign
R0394:Pi4kb UTSW 3 94996805 intron probably benign
R1485:Pi4kb UTSW 3 94994387 missense probably damaging 0.99
R3700:Pi4kb UTSW 3 94994288 missense probably benign 0.09
R4449:Pi4kb UTSW 3 94984735 missense probably benign 0.41
R4502:Pi4kb UTSW 3 94996607 missense probably benign 0.02
R4717:Pi4kb UTSW 3 94998851 missense probably damaging 1.00
R4737:Pi4kb UTSW 3 95004338 missense probably damaging 1.00
R4763:Pi4kb UTSW 3 95004409 intron probably benign
R5322:Pi4kb UTSW 3 94994249 missense probably benign 0.04
R5427:Pi4kb UTSW 3 94994207 missense probably benign 0.09
R5622:Pi4kb UTSW 3 94998861 missense possibly damaging 0.56
R5755:Pi4kb UTSW 3 94994297 splice site probably null
R5926:Pi4kb UTSW 3 94998996 missense probably damaging 1.00
R6904:Pi4kb UTSW 3 94993150 missense probably damaging 1.00
R6984:Pi4kb UTSW 3 94996934 missense probably damaging 1.00
R7221:Pi4kb UTSW 3 94994189 missense probably damaging 1.00
R7312:Pi4kb UTSW 3 94984577 missense probably benign 0.12
R7511:Pi4kb UTSW 3 94989312 missense probably benign 0.00
R7571:Pi4kb UTSW 3 94999114 critical splice donor site probably null
R7885:Pi4kb UTSW 3 94999076 missense probably damaging 1.00
R8327:Pi4kb UTSW 3 94998881 missense probably benign 0.02
R8331:Pi4kb UTSW 3 94996684 missense probably null 0.99
Z1088:Pi4kb UTSW 3 94984509 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTGCAAGCCTACATTGG -3'
(R):5'- TGCTGCTGAGACTTATGCTG -3'

Sequencing Primer
(F):5'- TACATTGGCAACCGGCTC -3'
(R):5'- TGGCCGTAGCATCTGACTTAGAAC -3'
Posted On2016-11-08