Incidental Mutation 'R5625:Gbp2b'
ID441778
Institutional Source Beutler Lab
Gene Symbol Gbp2b
Ensembl Gene ENSMUSG00000040264
Gene Nameguanylate binding protein 2b
SynonymsGbp1, Mpa1, Mag-1, Gbp-1, Mpa-1
MMRRC Submission 043164-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5625 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location142594847-142619179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 142599045 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 81 (W81R)
Ref Sequence ENSEMBL: ENSMUSP00000029936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029936]
Predicted Effect probably damaging
Transcript: ENSMUST00000029936
AA Change: W81R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029936
Gene: ENSMUSG00000040264
AA Change: W81R

DomainStartEndE-ValueType
Pfam:GBP 18 280 4.1e-122 PFAM
Pfam:GBP_C 282 578 5.5e-125 PFAM
Meta Mutation Damage Score 0.9539 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanylate-binding protein (GBP) family. GBPs specifically bind guanine nucleotides (GMP, GDP, and GTP) and contain two of the three consensus motifs found in typical GTP-binding proteins. The encoded protein interacts with a member of the germinal center kinase family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T G 9: 44,278,036 D388A probably benign Het
Ampd3 A C 7: 110,802,523 E408A probably damaging Het
BC027072 T A 17: 71,751,326 D452V probably damaging Het
Bmp1 G T 14: 70,486,166 N743K probably benign Het
Brsk1 A G 7: 4,706,400 K398E probably damaging Het
Ccdc157 A T 11: 4,151,888 M11K probably damaging Het
Cep295 A C 9: 15,340,891 M394R probably damaging Het
Cfap44 G T 16: 44,460,347 probably null Het
Col13a1 C T 10: 61,843,609 G713R unknown Het
Cxcr2 A T 1: 74,158,832 K162* probably null Het
Cyp3a44 C T 5: 145,779,566 D405N possibly damaging Het
Exo1 G T 1: 175,893,814 D340Y possibly damaging Het
Farp2 T G 1: 93,528,748 L51R probably damaging Het
Fat4 A T 3: 38,888,934 I659F possibly damaging Het
Gipc2 C T 3: 152,165,904 probably benign Het
Gm10941 G T 10: 77,258,836 probably benign Het
Gm1988 A T 7: 39,173,805 noncoding transcript Het
Hapln3 G T 7: 79,117,258 probably null Het
Ifi213 A G 1: 173,569,063 S482P possibly damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Lrrn1 T A 6: 107,567,354 C38S probably damaging Het
Mycbpap T C 11: 94,505,693 E107G probably damaging Het
Neb A T 2: 52,177,535 L5848* probably null Het
Nrg3 A T 14: 38,370,993 M545K probably damaging Het
Nudt3 A G 17: 27,583,228 L28P probably damaging Het
Olfr955 T A 9: 39,469,803 M308L probably benign Het
Otop1 A T 5: 38,302,761 Y557F probably damaging Het
Pdgfra G A 5: 75,189,337 probably null Het
Pi4kb A G 3: 94,984,677 M223V probably benign Het
Piezo1 T C 8: 122,482,960 T2335A probably benign Het
Ppp6c A G 2: 39,197,441 V251A probably benign Het
Prkg1 C T 19: 31,764,762 E21K possibly damaging Het
Ptpru T C 4: 131,803,380 E521G probably null Het
Rasl10b G T 11: 83,418,814 R199L probably damaging Het
Rhbdf2 G A 11: 116,605,377 R111C probably damaging Het
Sec23ip G T 7: 128,744,983 probably benign Het
Sptbn5 A T 2: 120,079,792 noncoding transcript Het
Srsf11 C T 3: 158,023,344 probably benign Het
Syne2 T C 12: 76,095,112 S6141P probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tex46 T C 4: 136,610,614 F39S probably damaging Het
Tmem50a AACCA AA 4: 134,898,467 probably benign Het
Tmem62 G T 2: 120,990,393 W180L probably damaging Het
Tnxb G A 17: 34,685,211 A1232T probably benign Het
Tubgcp3 T C 8: 12,624,888 H744R possibly damaging Het
Uggt2 A G 14: 119,077,724 I311T probably damaging Het
Usp8 C T 2: 126,742,277 R469C probably damaging Het
Vmn1r19 T C 6: 57,405,296 L278S probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Vmn2r-ps159 A T 4: 156,334,210 noncoding transcript Het
Wdr93 A G 7: 79,771,018 T376A probably benign Het
Zfp575 G A 7: 24,585,652 A188V possibly damaging Het
Other mutations in Gbp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Gbp2b APN 3 142598312 missense probably damaging 1.00
IGL01892:Gbp2b APN 3 142603620 missense probably benign 0.03
IGL01989:Gbp2b APN 3 142611440 missense probably benign 0.19
IGL02019:Gbp2b APN 3 142606990 missense possibly damaging 0.52
IGL02338:Gbp2b APN 3 142604226 missense probably benign 0.09
IGL02657:Gbp2b APN 3 142604112 missense probably damaging 1.00
IGL03148:Gbp2b APN 3 142606881 missense probably benign 0.00
FR4304:Gbp2b UTSW 3 142603652 missense probably benign 0.00
FR4340:Gbp2b UTSW 3 142603652 missense probably benign 0.00
FR4342:Gbp2b UTSW 3 142603652 missense probably benign 0.00
FR4589:Gbp2b UTSW 3 142603652 missense probably benign 0.00
R0329:Gbp2b UTSW 3 142608176 missense probably benign 0.01
R0345:Gbp2b UTSW 3 142608183 missense probably damaging 1.00
R0358:Gbp2b UTSW 3 142606789 missense probably damaging 1.00
R0732:Gbp2b UTSW 3 142606978 missense probably benign
R1163:Gbp2b UTSW 3 142599096 missense probably damaging 1.00
R1550:Gbp2b UTSW 3 142606830 missense probably damaging 0.99
R1629:Gbp2b UTSW 3 142610974 missense possibly damaging 0.93
R1886:Gbp2b UTSW 3 142608302 missense probably benign
R1887:Gbp2b UTSW 3 142608302 missense probably benign
R2188:Gbp2b UTSW 3 142608279 missense probably benign 0.44
R2261:Gbp2b UTSW 3 142606735 missense probably benign 0.00
R3977:Gbp2b UTSW 3 142603709 missense probably benign 0.02
R4718:Gbp2b UTSW 3 142598995 missense probably damaging 1.00
R4788:Gbp2b UTSW 3 142611410 missense probably benign 0.21
R4807:Gbp2b UTSW 3 142598245 missense probably benign 0.02
R5042:Gbp2b UTSW 3 142611463 missense probably benign 0.03
R5087:Gbp2b UTSW 3 142598254 missense probably damaging 1.00
R5114:Gbp2b UTSW 3 142598185 missense probably damaging 1.00
R5414:Gbp2b UTSW 3 142599091 missense probably damaging 1.00
R5567:Gbp2b UTSW 3 142611365 missense possibly damaging 0.75
R5685:Gbp2b UTSW 3 142608158 missense probably benign
R6030:Gbp2b UTSW 3 142603653 missense probably benign 0.00
R6030:Gbp2b UTSW 3 142603653 missense probably benign 0.00
R6408:Gbp2b UTSW 3 142618138 missense probably benign 0.00
R6500:Gbp2b UTSW 3 142611491 missense probably benign 0.06
R6581:Gbp2b UTSW 3 142608238 nonsense probably null
R6582:Gbp2b UTSW 3 142611040 missense possibly damaging 0.53
R6847:Gbp2b UTSW 3 142598179 missense probably damaging 0.96
R6923:Gbp2b UTSW 3 142600559 missense probably benign 0.01
R7120:Gbp2b UTSW 3 142606746 missense probably benign 0.01
R7255:Gbp2b UTSW 3 142608117 missense probably damaging 1.00
R7454:Gbp2b UTSW 3 142598159 missense possibly damaging 0.75
R7643:Gbp2b UTSW 3 142603609 missense probably benign 0.07
R8039:Gbp2b UTSW 3 142618164 missense probably benign 0.02
R8312:Gbp2b UTSW 3 142599051 missense probably benign
R8312:Gbp2b UTSW 3 142599054 missense probably damaging 0.96
R8391:Gbp2b UTSW 3 142604133 missense probably damaging 1.00
R8418:Gbp2b UTSW 3 142603705 missense probably benign 0.01
Z1177:Gbp2b UTSW 3 142604316 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATCAGCATTGGATGTTCTGCAC -3'
(R):5'- ACTCTTGGTTCCTATGTTAGGTAAG -3'

Sequencing Primer
(F):5'- GCATTGGATGTTCTGCACTCCATG -3'
(R):5'- GTTCCTATGTTAGGTAAGTGATACAC -3'
Posted On2016-11-08