Incidental Mutation 'R5625:Srsf11'
ID441780
Institutional Source Beutler Lab
Gene Symbol Srsf11
Ensembl Gene ENSMUSG00000055436
Gene Nameserine/arginine-rich splicing factor 11
Synonyms0610009J05Rik, Sfrs11, 2610019N13Rik
MMRRC Submission 043164-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5625 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location158010473-158036639 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 158023344 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069025] [ENSMUST00000072875] [ENSMUST00000121326] [ENSMUST00000126716] [ENSMUST00000137444] [ENSMUST00000198705]
Predicted Effect probably benign
Transcript: ENSMUST00000069025
SMART Domains Protein: ENSMUSP00000063916
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 64 88 N/A INTRINSIC
low complexity region 91 114 N/A INTRINSIC
low complexity region 186 264 N/A INTRINSIC
low complexity region 271 310 N/A INTRINSIC
low complexity region 328 335 N/A INTRINSIC
low complexity region 365 374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072875
SMART Domains Protein: ENSMUSP00000072651
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
low complexity region 117 141 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 239 317 N/A INTRINSIC
low complexity region 327 409 N/A INTRINSIC
low complexity region 428 435 N/A INTRINSIC
low complexity region 465 474 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000089922
Predicted Effect probably benign
Transcript: ENSMUST00000121326
SMART Domains Protein: ENSMUSP00000113685
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
RRM 62 136 3.13e-7 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 179 202 N/A INTRINSIC
low complexity region 274 352 N/A INTRINSIC
low complexity region 362 444 N/A INTRINSIC
low complexity region 463 470 N/A INTRINSIC
low complexity region 500 509 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126716
SMART Domains Protein: ENSMUSP00000114370
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133090
Predicted Effect probably benign
Transcript: ENSMUST00000137444
SMART Domains Protein: ENSMUSP00000122686
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
low complexity region 117 141 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140491
SMART Domains Protein: ENSMUSP00000118767
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
Blast:RRM 2 42 1e-21 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000115487
Gene: ENSMUSG00000055436
AA Change: R90Q

DomainStartEndE-ValueType
RRM 7 81 3.13e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152274
SMART Domains Protein: ENSMUSP00000127239
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 64 88 N/A INTRINSIC
low complexity region 91 114 N/A INTRINSIC
low complexity region 186 264 N/A INTRINSIC
low complexity region 274 356 N/A INTRINSIC
low complexity region 375 382 N/A INTRINSIC
low complexity region 412 421 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199520
Predicted Effect probably benign
Transcript: ENSMUST00000198705
SMART Domains Protein: ENSMUSP00000142759
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 81 175 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T G 9: 44,278,036 D388A probably benign Het
Ampd3 A C 7: 110,802,523 E408A probably damaging Het
BC027072 T A 17: 71,751,326 D452V probably damaging Het
Bmp1 G T 14: 70,486,166 N743K probably benign Het
Brsk1 A G 7: 4,706,400 K398E probably damaging Het
Ccdc157 A T 11: 4,151,888 M11K probably damaging Het
Cep295 A C 9: 15,340,891 M394R probably damaging Het
Cfap44 G T 16: 44,460,347 probably null Het
Col13a1 C T 10: 61,843,609 G713R unknown Het
Cxcr2 A T 1: 74,158,832 K162* probably null Het
Cyp3a44 C T 5: 145,779,566 D405N possibly damaging Het
Exo1 G T 1: 175,893,814 D340Y possibly damaging Het
Farp2 T G 1: 93,528,748 L51R probably damaging Het
Fat4 A T 3: 38,888,934 I659F possibly damaging Het
Gbp2b T A 3: 142,599,045 W81R probably damaging Het
Gipc2 C T 3: 152,165,904 probably benign Het
Gm10941 G T 10: 77,258,836 probably benign Het
Gm1988 A T 7: 39,173,805 noncoding transcript Het
Hapln3 G T 7: 79,117,258 probably null Het
Ifi213 A G 1: 173,569,063 S482P possibly damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Lrrn1 T A 6: 107,567,354 C38S probably damaging Het
Mycbpap T C 11: 94,505,693 E107G probably damaging Het
Neb A T 2: 52,177,535 L5848* probably null Het
Nrg3 A T 14: 38,370,993 M545K probably damaging Het
Nudt3 A G 17: 27,583,228 L28P probably damaging Het
Olfr955 T A 9: 39,469,803 M308L probably benign Het
Otop1 A T 5: 38,302,761 Y557F probably damaging Het
Pdgfra G A 5: 75,189,337 probably null Het
Pi4kb A G 3: 94,984,677 M223V probably benign Het
Piezo1 T C 8: 122,482,960 T2335A probably benign Het
Ppp6c A G 2: 39,197,441 V251A probably benign Het
Prkg1 C T 19: 31,764,762 E21K possibly damaging Het
Ptpru T C 4: 131,803,380 E521G probably null Het
Rasl10b G T 11: 83,418,814 R199L probably damaging Het
Rhbdf2 G A 11: 116,605,377 R111C probably damaging Het
Sec23ip G T 7: 128,744,983 probably benign Het
Sptbn5 A T 2: 120,079,792 noncoding transcript Het
Syne2 T C 12: 76,095,112 S6141P probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tex46 T C 4: 136,610,614 F39S probably damaging Het
Tmem50a AACCA AA 4: 134,898,467 probably benign Het
Tmem62 G T 2: 120,990,393 W180L probably damaging Het
Tnxb G A 17: 34,685,211 A1232T probably benign Het
Tubgcp3 T C 8: 12,624,888 H744R possibly damaging Het
Uggt2 A G 14: 119,077,724 I311T probably damaging Het
Usp8 C T 2: 126,742,277 R469C probably damaging Het
Vmn1r19 T C 6: 57,405,296 L278S probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Vmn2r-ps159 A T 4: 156,334,210 noncoding transcript Het
Wdr93 A G 7: 79,771,018 T376A probably benign Het
Zfp575 G A 7: 24,585,652 A188V possibly damaging Het
Other mutations in Srsf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Srsf11 APN 3 158012035 unclassified probably benign
IGL01600:Srsf11 APN 3 158019442 splice site probably benign
IGL02724:Srsf11 APN 3 158016431 unclassified probably benign
IGL03147:Srsf11 UTSW 3 158026740 missense probably damaging 1.00
R0195:Srsf11 UTSW 3 158036535 unclassified probably benign
R0578:Srsf11 UTSW 3 158012067 unclassified probably benign
R0580:Srsf11 UTSW 3 158012067 unclassified probably benign
R1075:Srsf11 UTSW 3 158012790 intron probably benign
R1604:Srsf11 UTSW 3 158019311 critical splice donor site probably null
R1797:Srsf11 UTSW 3 158019428 missense possibly damaging 0.92
R1815:Srsf11 UTSW 3 158016427 unclassified probably benign
R1899:Srsf11 UTSW 3 158031580 unclassified probably benign
R2105:Srsf11 UTSW 3 158019345 missense probably damaging 0.99
R4605:Srsf11 UTSW 3 158022923 nonsense probably null
R4655:Srsf11 UTSW 3 158023335 missense probably benign 0.15
R4737:Srsf11 UTSW 3 158026732 nonsense probably null
R5244:Srsf11 UTSW 3 158023344 unclassified probably benign
R5245:Srsf11 UTSW 3 158023344 unclassified probably benign
R5379:Srsf11 UTSW 3 158023344 unclassified probably benign
R5401:Srsf11 UTSW 3 158023344 unclassified probably benign
R5763:Srsf11 UTSW 3 158023344 unclassified probably benign
R5814:Srsf11 UTSW 3 158023344 unclassified probably benign
R5938:Srsf11 UTSW 3 158023344 unclassified probably benign
R5944:Srsf11 UTSW 3 158023344 unclassified probably benign
R5945:Srsf11 UTSW 3 158023344 unclassified probably benign
R6126:Srsf11 UTSW 3 158023344 unclassified probably benign
R6175:Srsf11 UTSW 3 158023344 unclassified probably benign
R6427:Srsf11 UTSW 3 158023344 unclassified probably benign
R6435:Srsf11 UTSW 3 158023344 unclassified probably benign
R6436:Srsf11 UTSW 3 158023344 unclassified probably benign
R6614:Srsf11 UTSW 3 158023344 unclassified probably benign
R6616:Srsf11 UTSW 3 158023344 unclassified probably benign
R7615:Srsf11 UTSW 3 158016425 missense unknown
X0017:Srsf11 UTSW 3 158016349 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACACCACCTGAGTTTGTTGAAAG -3'
(R):5'- AGCCCTACTCTTGATTCCAACAG -3'

Sequencing Primer
(F):5'- GTCAGAATGAAACTTCAATGTGTG -3'
(R):5'- ACTCTTGATTCCAACAGAATATTTCC -3'
Posted On2016-11-08