Mutagenetix > Incidental Mutation

Incidental Mutation 'R5625:Szt2'

441781

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

MMRRC Submission

043164-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.539) question?

Stock #

R5625 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118373217 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 2653 (V2653A)

Ref Sequence

ENSEMBL: ENSMUSP00000074862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075406]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000075406
AA Change: V2653A

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: V2653A

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138386

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138632

Predicted Effect

unknown
Transcript: ENSMUST00000183402
AA Change: V184A

Meta Mutation Damage Score

0.1171

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg4	T	G	9: 44,278,036	D388A	probably benign	Het
Ampd3	A	C	7: 110,802,523	E408A	probably damaging	Het
BC027072	T	A	17: 71,751,326	D452V	probably damaging	Het
Bmp1	G	T	14: 70,486,166	N743K	probably benign	Het
Brsk1	A	G	7: 4,706,400	K398E	probably damaging	Het
Ccdc157	A	T	11: 4,151,888	M11K	probably damaging	Het
Cep295	A	C	9: 15,340,891	M394R	probably damaging	Het
Cfap44	G	T	16: 44,460,347		probably null	Het
Col13a1	C	T	10: 61,843,609	G713R	unknown	Het
Cxcr2	A	T	1: 74,158,832	K162*	probably null	Het
Cyp3a44	C	T	5: 145,779,566	D405N	possibly damaging	Het
Exo1	G	T	1: 175,893,814	D340Y	possibly damaging	Het
Farp2	T	G	1: 93,528,748	L51R	probably damaging	Het
Fat4	A	T	3: 38,888,934	I659F	possibly damaging	Het
Gbp2b	T	A	3: 142,599,045	W81R	probably damaging	Het
Gipc2	C	T	3: 152,165,904		probably benign	Het
Gm10941	G	T	10: 77,258,836		probably benign	Het
Gm1988	A	T	7: 39,173,805		noncoding transcript	Het
Hapln3	G	T	7: 79,117,258		probably null	Het
Ifi213	A	G	1: 173,569,063	S482P	possibly damaging	Het
Insc	A	G	7: 114,829,067	T92A	probably damaging	Het
Lrrn1	T	A	6: 107,567,354	C38S	probably damaging	Het
Mycbpap	T	C	11: 94,505,693	E107G	probably damaging	Het
Neb	A	T	2: 52,177,535	L5848*	probably null	Het
Nrg3	A	T	14: 38,370,993	M545K	probably damaging	Het
Nudt3	A	G	17: 27,583,228	L28P	probably damaging	Het
Olfr955	T	A	9: 39,469,803	M308L	probably benign	Het
Otop1	A	T	5: 38,302,761	Y557F	probably damaging	Het
Pdgfra	G	A	5: 75,189,337		probably null	Het
Pi4kb	A	G	3: 94,984,677	M223V	probably benign	Het
Piezo1	T	C	8: 122,482,960	T2335A	probably benign	Het
Ppp6c	A	G	2: 39,197,441	V251A	probably benign	Het
Prkg1	C	T	19: 31,764,762	E21K	possibly damaging	Het
Ptpru	T	C	4: 131,803,380	E521G	probably null	Het
Rasl10b	G	T	11: 83,418,814	R199L	probably damaging	Het
Rhbdf2	G	A	11: 116,605,377	R111C	probably damaging	Het
Sec23ip	G	T	7: 128,744,983		probably benign	Het
Sptbn5	A	T	2: 120,079,792		noncoding transcript	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Syne2	T	C	12: 76,095,112	S6141P	probably benign	Het
Tex46	T	C	4: 136,610,614	F39S	probably damaging	Het
Tmem50a	AACCA	AA	4: 134,898,467		probably benign	Het
Tmem62	G	T	2: 120,990,393	W180L	probably damaging	Het
Tnxb	G	A	17: 34,685,211	A1232T	probably benign	Het
Tubgcp3	T	C	8: 12,624,888	H744R	possibly damaging	Het
Uggt2	A	G	14: 119,077,724	I311T	probably damaging	Het
Usp8	C	T	2: 126,742,277	R469C	probably damaging	Het
Vmn1r19	T	C	6: 57,405,296	L278S	probably damaging	Het
Vmn2r59	A	T	7: 42,046,460	I176N	probably benign	Het
Vmn2r-ps159	A	T	4: 156,334,210		noncoding transcript	Het
Wdr93	A	G	7: 79,771,018	T376A	probably benign	Het
Zfp575	G	A	7: 24,585,652	A188V	possibly damaging	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1942:Szt2	UTSW	4	118392620	missense	probably benign	0.17
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2044:Szt2	UTSW	4	118376448	nonsense	probably null
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3237:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3878:Szt2	UTSW	4	118390585	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4597:Szt2	UTSW	4	118372681	missense	unknown
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4670:Szt2	UTSW	4	118375829	unclassified	probably benign
R4704:Szt2	UTSW	4	118393829	missense	probably damaging	0.99
R4748:Szt2	UTSW	4	118389191	nonsense	probably null
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4809:Szt2	UTSW	4	118388985	missense	probably damaging	1.00
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5808:Szt2	UTSW	4	118372613	missense	unknown
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R6834:Szt2	UTSW	4	118388325	missense	probably benign	0.01
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7383:Szt2	UTSW	4	118365214	nonsense	probably null
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7896:Szt2	UTSW	4	118402913	missense	possibly damaging	0.62
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8309:Szt2	UTSW	4	118375482	frame shift	probably null
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8480:Szt2	UTSW	4	118386818	missense	probably benign	0.01
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R8992:Szt2	UTSW	4	118382788	splice site	probably benign
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9186:Szt2	UTSW	4	118385091	missense	probably damaging	1.00
R9424:Szt2	UTSW	4	118390954	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGAAGAGACCGAGCTTCTG -3'
(R):5'- GACTGCTGGGTAGTTGTCACAG -3'

Sequencing Primer
(F):5'- GCTTCTGGCTGAGCAGG -3'
(R):5'- GTAGTTGTCACAGACCCTTCAGAG -3'

Posted On

2016-11-08